8 clinical relevance for study of molecular mechanisms
Báo cáo sinh học: "Association between neuroserpin and molecular markers of brain damage in patients with acute ischemic stroke" pot
... MannWhitney test was used for continuous variables with non-Normal distribution, Student’s t test for continuous variables with Normal distribution and Chi-square test for proportions between patients ... accept to participate and patients were lost during the follow-up, therefore, a total of 129 patients were finally included in the study This research was carried out in accordance with the Declaration ... determined using GE Healthcare and Biohit Plc ELISA kits, respectively For neuroserpin quantification, a sandwich ELISA was performed as described previously [6,9,10] Each sample was assayed in duplicate...
- 7
- 541
- 0
báo cáo hóa học:" Association between neuroserpin and molecular markers of brain damage in patients with acute ischemic stroke" pdf
... MannWhitney test was used for continuous variables with non-Normal distribution, Student’s t test for continuous variables with Normal distribution and Chi-square test for proportions between patients ... accept to participate and patients were lost during the follow-up, therefore, a total of 129 patients were finally included in the study This research was carried out in accordance with the Declaration ... determined using GE Healthcare and Biohit Plc ELISA kits, respectively For neuroserpin quantification, a sandwich ELISA was performed as described previously [6,9,10] Each sample was assayed in duplicate...
- 7
- 404
- 0
Báo cáo khoa học: "Biological markers of lung injury before and after the institution of positive pressure ventilation in patients with acute lung injury" potx
... designed the study GC performed data acquisition GC and SB performed the immunoassays MC and MAM performed the data analysis and interpretation and drafted the manuscript MC and AS performed the ... Station, TX, USA) The values for the cytokine concentrations for IL-6, IL-8, and ICAM-1 were not normally distributed; therefore, we carried out natural log transformation to achieve normal distribution ... 300 for ALI and less than 200 for ARDS, acute onset of bilateral infiltrates on a chest radiograph, and pulmonary artery wedge pressure less than 18 mmHg or no Available online http://ccforum.com/content/10/5/R126...
- 8
- 271
- 0
Báo cáo y học: "Technical Considerations in Decompressive Craniectomy in the Treatment of Traumatic Brain Injury"
... the room that it can provide for the expansion of the brain is restricted; furthermore, this procedure may lead to temporal lobe herniation and necrosis.18 A study performed by Alexander et al demonstrated ... except for the technical considerations of this operation, timely decompressive craniectomy before the development of irreversible changes in the injured brain would be equally important for patient ... craniectomy/hemisphere craniectomy for lesions or swelling confined to one cerebral hemisphere, and bifrontal craniectomy for diffuse swelling, are recommended for the management of traumatic refractory...
- 6
- 627
- 0
awareness of deficit after brain injury clinical and theoretical issues jan 1991
... Department of Psychology University of Arizona Tucson, Arizona New York Oxford OXFORD UNIVERSITY PRESS 1991 Oxford University Press Oxford New York Toronto Delhi Bombay Calcutta Madras Karachi Petaling ... Copyright © 1991 by Oxford University Press, Inc Published by Oxford University Press, Inc., 200 Madison Avenue, New York, New York 10016 Oxford is a registered trademark of Oxford University Press ... 1988) Thus, for example, amnestic patients who lack explicit, conscious memory for recent experiences nevertheless possess intact implicit memory for various aspects of those experiences (for review,...
- 285
- 225
- 0
Báo cáo hóa học: " Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury" ppt
... Page of study [13] Sugarman et al report the feasibility and outcome of the WBB with a commercial program for balance training after stroke [14] Although this software is not designed for balance ... laboratory-grade force platform, which is considered the gold standard measure of balance The results suggest that the WBB could be considered as a valid portable low-cost tool for assessing standing ... their efficacy Therefore, we designed eBaViR, a virtual rehabilitation system for balance recovery that provides motivational task oriented exercises specifically designed for ABI people by clinical...
- 10
- 732
- 0
báo cáo hóa học: "Usability of a virtual reality environment simulating an automated teller machine for assessing and training persons with acquired brain injury" pdf
... the cognitive performance of the participants in both parts of the study Written and informed consent was obtained from all participants before study enrollment The study was performed in accordance ... designed the VR-ATM CKKY formulated concepts and ideas in Part I of the study WAKY and YEWH collected and analyzed data for Part I KNKF formulated concepts in Part II of the study CBCH, LKCK, LJCK, ... compared for each step Two behavioral checklists were developed based on activity analysis, a 14-item one for cash withdrawals and a 17-item one for money transfers, to assess the participants' performance...
- 9
- 454
- 0
báo cáo hóa học: " Inhibition of the alternative complement activation pathway in traumatic brain injury by a monoclonal anti-factor B antibody: a randomized placebo-controlled study in mice" pot
... X-100 solution for 60 at RT for permeabilization Slides were then incubated with the TdT-enzyme in reaction buffer containing fluorescein-dUTP for 90 at 37°C Negative control was performed using ... antibody and performed the zymosan assay IL, AMH, MET, and MR performed the TUNEL and immunohistochemistry experiments IL, MR and DH performed the real-time RT-PCR analyses DR and PAW performed the ... monoclonal anti-NeuN for neurons (1:2,000; Chemicon, Hampshire, UK); polyclonal rabbit anti-GFAP for astrocytes (1:100; Shandon Immunon, Pittsburgh, PA) and monoclonal rat anti-CD11b for microglia and...
- 12
- 465
- 0
báo cáo hóa học: " Air pollution & the brain: Subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease" pdf
... snap frozen and stored at -80C° For the current study, only one hemisphere of the brain was available for analysis Housing and experimental use of the animals were performed in strict accordance ... Rockford, IL) Samples were spun at 4°C 14,000 g for minutes and supernatant was collected for analysis Protein concentration was determined by the BCA protein assay (Thermo Scientific, Rockford, ... hourly for the two highest exposure levels and every hours for the lowest two DE exposures A single filter sample was collected each day from the control chamber While the levels of DE in this study...
- 10
- 375
- 0
báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc
... Immunostaining was performed against AQP4, ED1 and Iba1 (for macrophages and microglia), IgG (for serum protein accumulation secondary to BBB alteration) and GFAP (for astrocytes) Immunostaining For immunohistochemistry, ... AQP4 Isoform 1: NM_012825.3 Sens: TTGGACCAATCATAGGCGC 770 to 788 Isoform 213 pb 98.2% 90 pb 102.0% 778 to 796 Isoform Isoform 2: NM_001142366.1 Revs: GGTCAATGTCGATCACATGC 963 to 982 Isoform NM_017009.2 ... MR scans conducted just before sacrifice (n = 25) By introducing the repetitive MR scans that were performed before sacrifice (two to three scans per animal except for dpi, total = 49) and by...
- 16
- 393
- 0
báo cáo hóa học: " Origin and consequences of brain Toll-like receptor 4 pathway stimulation in an experimental model of depression" docx
... Mortlake, NSW, Australia) The primers used were: for iNOS, forward: 5’-GGA CCA CCT CTA TCA GGA A-3’, and reverse: 5’-CCT CAT GAT AAC GTT TCT GGC-3’, for COX-2 forward: 5’-CTT CGG GAG CAC AAC AGA G-3’, ... reverse: 5’-GCG GAT GCC AGT GAT AGA G-3’, for TLR4, forward: 5’-AGT TGG CTC TGC CAA GTC TCA GAT- 3’, reverse: 5’-TGG CAC TCA TCA GGA TGA CAC CAT-3’, for MD-2 forward: 5’-CAT AGA ATT GCC GAA GCG CAA ... CAT CTG TGA TGG CCC TTA GGA-3’, for NFB subunit p65, forward: 5’-CAT GCG TTT CCG TTA CAA GTG CGA-3’, reverse: 5’-TGG GTG CGT CTT AGT GGT ATC TGT-3’, for IBa forward: 5’-TGG CCT TCC TCA ACT...
- 14
- 422
- 0
báo cáo hóa học: " Interleukin-1alpha expression precedes IL-1beta after ischemic brain injury and is localised to areas of focal neuronal loss and penumbral tissues" pdf
... injured areas is not uniform suggesting that it is regulated Conclusions The early expression of IL-1α in areas of focal neuronal injury suggests that it is the major form of IL-1 contributing ... very little direct evidence that IL-1β protein is produced, and almost no information is available about IL-1α In this study we sought to determine the spatial distribution of IL-1α and IL-1β in ... IL-1α-positive microglia were present in the cerebral cortex, the piriform cortex, the ventral striatum and the thalamus Immunohistochemistry for IL-1α, with cresyl violet co-staining, localized IL1α expressing...
- 16
- 425
- 0
Báo cáo y học: "Plasmatic B-Type Natriuretic Peptide and C-Reactive Protein in Hyperacute Stroke as Markers of Ct-Evidence of Brain Edema." pptx
... 6.54) For patients with ischemic stroke the baseline NIHSS was 7.6 (SD: 5.4) and 7.3 (SD: 5.1) for those with hemorrhage The mean NIHSS score for patients with edema was 11.77 (SD: 6.5) and for ... CT and, therefore, we focused only on severe edema The practice of Diffusion weighted MRI would have added important information but unfortunately this technique was unavailable for us In conclusion, ... value of CRP for patients with edema was 4.7 mg/dl in comparison to 0.78 for patients without edema (p=0.001on MW-U-test), see figure The difference remained significant after controlling for hypertension,...
- 6
- 354
- 0
Theory of Brain Function quantum mechanics and superstrings - part 4 ppt
... suggestive for a possible use of MTs as “information processors” It should be rather obvious that such a delicate, fine MT organization is there for some good reason 32 Further evidence for the ... conformational changes In the case of MTs, the programmable and adaptable nature of the tubulin conformational states can be easily used to represent and propagate information Further evidence for ... of information from one point to other in MT, by transforming the hexagonal surface organization into a new cubic state Undoubtedly, microtubule symmetry and structure are optimal for information...
- 10
- 247
- 0
Traumatic brain injury and the effects of diazepam, diltiazem, and MK-801 on GABA-A receptor subunit expression in rat hippocampus ppt
... density for each blot, where the mean sham density was normalized at 100 Therefore, OD measurements for each band in both studies were defined in ROD units, relative to the mean sham OD per blot Study ... used for time point comparisons for each subunit The results of this analysis indicated that the 24 hour post-injury time point revealed the greatest changes across the most subunits Therefore, ... treated) for each of the drug treatments Due to the relative importance of γ2 and the various α subunits to BZ-type GABAAR pharmacological function, α1, α2, α3, and γ2 were chosen for inclusion in Study...
- 11
- 424
- 0
Báo cáo y học: "Regional characterization of energy metabolism in the brain of normal and MPTP-intoxicated mice using new markers of glucose and phosphate transport" doc
... to the incubation with either HRBD (ligand for GLUT1), GRBD (ligand for PiT1) or AmphoΔSU (ligand for PiT2) Several fixation protocols including 4% paraformaldehyde have been evaluated 100% ethanol ... Scientific, Rockford, USA) Conditioned media were frozen at -20°C until further use Concentrated supernatants were clarified by centrifugation at 2300 g for 10 minutes at 4°C before use Animals ... and 485-535 nm emission filter for Alexa 488, 530-585 nm excitation filter and 615∞ nm emission filter for CellTrace BODIPY (intracellular membranes) Image scans for each probe were acquired in...
- 9
- 776
- 1
Textbook of Traumatic Brain Injury - part 1 ppt
... brain lesions, and for this purpose, specific data were retrieved from the 1981 San Diego County cohort study (Kraus et al 1984) In this study, clinical information was uniformly recorded from ... injury, we have drawn some information from a large brain injury cohort study conducted in San Diego County, California, during the early 1980s (Kraus et al 1984) For the purposes of this chapter, ... in age and level of hypotension are not known Information on other factors is incomplete, and data for predictive factors for moderate and mild forms of TBI are not available Estimating Brain...
- 62
- 279
- 4
Textbook of Traumatic Brain Injury - part 2 potx
... et al.’s (1994) original for the standard comparisons as referenced for rating pathology The Victoroff et al (1994) method for rating WM hyperintensities can be adapted for use in rating WM pathology ... concentration in the brain does not change (e.g., for research purposes, one could not perform a vision activation study and then an auditory study on one patient using the same tracer injection) ... Emission Tomography There are no SPECT tracers for the study of cerebral metabolism Interpretation is often performed by visual rating of scans for abnormalities rather than by use of statistical...
- 66
- 383
- 6
Textbook of Traumatic Brain Injury - part 3 pot
... assessment, memory for verbal and visual information is formally measured Memory for material immediately after the material has been presented is referred to as immediate memory Memory for information ... powerful and informative methods for studying cerebral function and dysfunction after TBI In this section, results of studies using each of these electrophysiological techniques of particular relevance ... and informationprocessing capacity It is a 10-minute test that was originally designed for adults but currently has versions appropriate for children ages 9–15 years The ACT is useful for a variety...
- 61
- 267
- 2
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25