88 vhdl model of a 16 bit register with many features

... size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that ... results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic ... (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant acid phosphatase (TRAP) staining in order to demonstrate the osteoclasts Deparaffinized...

Ngày tải lên: 20/06/2014, 04:20

... W Fig The Rashba parameter as a function of z The horizontal and vertical dashed lines indicate the value of a0 and the borderline of the QW, respectively Fig The change in spin-orbit splitting ... a hydrogenic donor impurity in a GaAs=Ga0:65 Al0:35 As QW We take the effective mass parameters of [13] and the Rashba parameter a0 ¼ 10À12 eV m [14] The spin-orbit splitting energy C is defined ... jzj W; W aR ðzÞ ¼ ð3Þ for jzj [ W; where a0 is the maximum value of the Rashba spin-orbit effect at the side of the QW The Rashba parameter is a function of z and is dependent on the size of the...

Ngày tải lên: 22/06/2014, 01:20

... (ICASSP ’01), vol 4, pp 2621–2624, Salt Lake City, Utah, USA, May 2001 [6] M A Aldajani and A H Sayed, “Stability and performance analysis of an adaptive sigma-delta modulator,” IEEE Transactions ... Processing, vol 2007, Article ID 162 86, pages, 2007 [8] G S Tombras and C A Karybakas, “New adaptation algorithm for a two-digit adaptive delta modulation system,” International Journal of Electronics, ... M A Aldajani and A H Sayed, A stable adaptive structure for delta modulation with improved performance,” in Proceedings of the IEEE International Conference on Acoustics, Speech, and Signal...

Ngày tải lên: 22/06/2014, 19:20

... Next state logic 2:0 RBA RF 8:6 RWA Bus Bus Bus Bus Bus SR 16 16 DATA AD 16 Din 16 ADDR ALU MEM Status Control RW CS Dout Output Logic (a) Datapath design with register file only Datapath control ... state logic Bus Bus Bus Bus Bus SR RAA RBA RWA RF PC AR DR DATA AD ALU 1 Din 6 ADDR ADD MEM Status Control RW CS Dout Output Logic (a) Datapath design with pipelined functional unit Datapath ... state logic RWA PC 16 Bus Bus Bus Bus Bus SR AR DR 16 DATA AD 16 Din 16 ALU ADDR ADD MEM Status RW CS Output Logic Dout16 (a) Datapath design with multi-cycle memory control I/O Datapath p3 p4...

Ngày tải lên: 02/07/2014, 12:46

... than a month She began having regular menstrual cycles again, and was able to maintain her weight at an appropriate level One year after discharge from the hospital, her weight was 53 kg, and ... create a plan that included appropriate, high-level out-patient therapy for severe anorexia along with continued medical management by both the patient's pediatrician and gastroenterologist An ability ... portion of the duodenum between the SMA and the aorta [4] In our patient, SMA syndrome resulted from weight loss associated with anorexia nervosa The Diagnostic and Statistical Manual of Mental Disorders,...

Ngày tải lên: 11/08/2014, 17:21

Ngày tải lên: 13/11/2014, 10:12

... cardinals are overlapped by extenders Woodin’s derived model theorem plays a important role in analysis of premice with Woodin cardinals Models of determinacy appears when we reach Woodin cardinals ... HOD analysis of AD+ models below LST (the largest ✓ is a Suslin cardinal) The translation is likely to generalize as long as HOD of an AD+ model is well understood A plausible conjecture is that ... this paper, an iteration tree is always a normal tree ~ ~ By a stack, we mean a stack of iteration trees Stacks are usually denoted by T , U , etc, with a vector symbol on top ~ Let T be a stack...

Ngày tải lên: 09/09/2015, 17:54

... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies ... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... Cape Verde was used for soap production and for lamps Jatropha is a small tree or large shrub, which can reach a height of three to five meters, but under favorable conditions it can attain a...

Ngày tải lên: 05/09/2013, 16:11

... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...

Ngày tải lên: 18/02/2014, 14:20

... pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific sense primer (5¢-GCCG CTCGAGTTTGAGTTAGCCAGAAACTCC-3¢, ... of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms again placed the guinea pig together with artiodactyls and primates, thus supporting paraphyly albeit ... bp and an ORF of 1503 bp coding for a putative mitochondrial preprotein of 501 amino acids with a calculated molecular weight of 57.7 kDa (Fig 2) After Leu24 a cleavage site for the matrix-associated...

Ngày tải lên: 22/02/2014, 07:20

... π/3 with S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... important corollary of (ii), which exhibits a sharp contrast with the case of rigid rotations, is that the scaling ratio is bounded from above and below by an asymptotically universal constant regardless ... boundary of a drop U of minimal generation It then follows the boundary of U along a nontrivial arc I Finally, it returns along the boundaries of another chain of descendants of U until it reaches a...

Ngày tải lên: 14/03/2014, 22:20

... solar panels It exhibit a payback of 3.13 years The addition of and m2 of solar panels (cases 2-3) increases solar fraction up to 30% but also payback to 8.7 years, since the greater daily saving ... SCHEME OF SOLAR CAR (LATERAL AND REAR VIEW) The maximum panel area can be estimated as function of car dimensions and shape For the following calculations this simple geometrical model has been ... to the weight of the car body This latter has been obtained starting from a statistical analysis of small commercial cars, including some “microcars” A linear regression analysis has been performed,...

Ngày tải lên: 30/03/2014, 10:20

... and treatment J Oral Pathol Med 1994, 23:12 -16 Hashimoto J, Ohno I, Nakatsuka K, Yoshimura N, Takata S, Zamma M, Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget's ... as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic Surgery and ... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of...

Ngày tải lên: 20/06/2014, 04:20

... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge,...

Ngày tải lên: 22/06/2014, 22:20

... Israel E-mail address: brznsky@cs.bgu.ac.il E Braverman: Department of Mathematics and Statistics, University of Calgary, 2500 University Drive N.W., Calgary, Alberta T2N 1N4, Canada E-mail address: ... of Mathematical Analysis and Applications 165 (1992), no 2, 346–360 [16] Y Zhou, Oscillation and nonoscillation for difference equations with variable delays, Applied Mathematics Letters An International ... illustrates this fact Acknowledgments L Berezansky was partially supported by Israeli Ministry of Absorption E Braverman was partially supported by the NSERC Research Grant and the AIF Research Grant...

Ngày tải lên: 22/06/2014, 22:20

... free of metastatic adenocarcinoma The patient had an uneventful recovery On rectum examination one year later a palpable extramucosal mass was noticed at the anterior rectum wall An abdominal CT ... survival and it seems to increase as the primary tumor stage advance In this case, a sigmoid adenocarcinoma is infiltrating 2/3 of muscularis propria with four lymph nodes harvested free of metastatic ... Sigurdson ER, Hanlon AL, Mayer RJ, Macdonald JS, Catalano PJ, Haller DG: Colon cancer survival is associated with increasing number of lunph nodes analyzed: a secondary survey of intergroup trial INT-0089...

Ngày tải lên: 09/08/2014, 03:21

... 2.2 BAC vector preparation pBeloBAC11 was kindly provided by H Shizuya, Department of Biology, California Institute of Technology (Pasadena, Calif.) Preparation of pBeloBAC11 was carried out as ... Schibler L., Vaiman D., Oustry A. , Guinec N., Dangy-Caye A. L., Billault A. , Cribiu E.P., Construction and extensive characterization of a goat bacterial articial chromosome library with threefold ... DNA inserts with an acceptable genomic delity in a bacterial articial chromosome (BAC) library to obtain complete coverage of the genome In addition to increased clone delity and a low level of...

Ngày tải lên: 09/08/2014, 18:21

... Shirato H, Harada T, Harabayashi T, Hida K, Endo H, Kitamura K, Onimaru R, Yamazaki K, Kurauchi N, Shimizu T, Shinohara N, Matsushita M, DosakaAkita H, Miyasaka K: Feasibility of insertion/implantation ... fiducial marker placement fused to form an integrated target volume A margin of expansion of mm was used to create a clinical target volume (CTV) An additional expansion of mm was used to create a ... Fiducial markers carry several practical advantages The markers can be clearly visualized on MV imaging (Figure 9) Some centers that may not have newer modalities such as KV imaging or CBCT available...

Ngày tải lên: 10/08/2014, 23:20

... Postoperatively, the patient was given octreotide subcutaneously at a dosage of 0.1 mg three times a day for a total of 15 days to treat his pancreatic injury His haematocrit remained stable at about ... palpation The patient underwent laboratory and radiological examination consisting of x-rays of his head, cervical spine, lumbar spine, chest and abdomen His blood was cross-matched and an ultrasound ... and a Glasgow Coma Scale (GCS) score of 15 The patient experienced pain and tenderness on palpation of his right upper abdominal quadrant; the rest of his abdomen was soft and nontender to palpation...

Ngày tải lên: 11/08/2014, 02:21

... Cite this article as: Fritzsche et al.: Radiological and pathological findings of a metastatic composite paraganglioma with neuroblastoma in a man: a case report Journal of Medical Case Reports ... and encapsulated and displayed red, brown and black hemorrhagic and cystic areas consistent with the appearance of paragangliomas Meanwhile the caudal part, corresponding to the neuroblastoma, ... pheochromocytomas, whereas those that occur in paraganglia at other sites are called paragangliomas Pheochromocytomas or paragangliomas can occur sporadically or in association with inherited...

Ngày tải lên: 11/08/2014, 02:22