7 entering a new contact at a new organization
Telesales - Kĩ năng bán hàng qua điện thoại
Ngày tải lên :
13/01/2014, 14:14
... Displaying an Organizational Contact in the eBusiness Center Header Viewing All Contacts at an Organization Entering a New Contact for an Existing Organization Entering a New Contact ... Applications tables are interrelated, any change you make using Oracle Applications can update many tables at once But when you modify Oracle Applications data using anything other than Oracle Applications, ... unpredictable results throughout Oracle Applications When you use Oracle Applications to modify your data, Oracle Applications automatically checks that your changes are valid Oracle Applications also...
- 256
- 10.3K
- 76
Activity 5.2: Creating Use Cases
Ngày tải lên :
16/10/2013, 13:15
... 32 Activity 5.2: Creating Use Cases Exercise 1: Creating Use Cases ! Create uses cases for the consultants and administrative assistants Review the “Timesheet System” and “Timesheet Data Entry” ... case study Develop use cases for each section Develop as many as you can in the time allotted Divide your time equally between each section Use prose to describe each use case Identify the actor ... prose to describe each use case Identify the actor and system for each use case Next, you will discuss your answers with the class System Actor Use case ...
- 2
- 238
- 0
Activity 5.3: Creating Usage Scenarios
Ngày tải lên :
18/10/2013, 18:15
... 34 Activity 5.3: Creating Usage Scenarios Exercise 1: Creating Usage Scenarios You will create a total of six usage scenarios from the use cases that you identified in Activity 5.2 ! Create usage ... usage scenarios for the consultants and administrative assistants Work in groups assigned by the instructor Identify three use cases each for the consultants and the administrative assistants Review ... the class System: Actor: Use case: Scenario: Precondition: Task sequence Post condition: Exceptions Activity 5.3: Creating Usage Scenarios System: Actor: Use case: Scenario: Precondition: Task...
- 6
- 409
- 0
Creating the project office 19
Ngày tải lên :
08/11/2013, 00:15
... change agent • Applies effective strategies for managing change and achieving successful contact across the organization • Expects resistance and plans for surprises • Tames organizational chaos ... the easier it is later “Separate organizational from technical issues” is a lesson learned when working with a large cross-organizational effort on computer architectural issues We Contact 163 ... is a facilitator of this culture and its salvation for creating results Summary There is no more magic to tame organizational chaos other than basically putting in extra effort focused on relationships...
- 10
- 285
- 0
Tài liệu Activity 4.4: Creating a Future-State Usage Scenario pdf
Ngày tải lên :
10/12/2013, 16:16
... this space to create the future-state use cases Activity 4.4: Creating a Future-State Usage Scenario Exercise 2: Creating a Future-State Usage Scenario (30 minutes) ! Create a future-state usage ... 24 Activity 4.4: Creating a Future-State Usage Scenario Exercise 1: Creating a Future-State Use Case (30 minutes) ! Create a future-state use case Participate in small groups as assigned ... and Bardell, Inc case study Review the current-state use cases and usage scenarios Create future-state use cases for the client billing process by using the current-state use case as a template...
- 4
- 417
- 0
Tài liệu Activity 10.1: Creating and Distributing Preliminary Components pptx
Ngày tải lên :
21/12/2013, 06:16
... 86 Activity 10.1: Creating and Distributing Preliminary Components Exercise 1: Creating Preliminary Service Type Based Components (10 minutes) ! Create preliminary components Participate in small ... aware of possible component redundancy Distribute all the preliminary components based on data services according to where you have identified data services on the topology in Exercise Be aware ... redundancy Choose a team representative to present the preliminary component topology that you have just created After completing the above steps, you will discuss your responses with the class...
- 4
- 410
- 0
Tài liệu Activity 4.2: Creating a Logical Data Model ppt
Ngày tải lên :
21/12/2013, 06:16
... actions that define the relationship between each pair of entities, and label the line with the relationship verb This is the initial ER diagram for the logical data model Answer in v04_160 9a_ act42-1.bmp ... cardinality and existence characteristics of each of the relationships defined in Exercise ! Identify cardinality For each relationship on your ER diagram, ask the question “How many of the parent ... the cardinality of each relationship and denote the entities as parent or child ! Identify existence ! For each relationship on your ER diagram, ask the question “Can the child exist if the parent...
- 4
- 409
- 0
Tài liệu Activity 11.2: Creating an Initial User Interface Design pptx
Ngày tải lên :
24/01/2014, 10:20
... Incorporate terminology, concepts, and metaphors that are familiar to the consultant Activity 11.2: Creating an Initial User Interface Design Exercise 2: Design Feedback and User Assistance (10 ... 96 Activity 11.2: Creating an Initial User Interface Design Exercise 1: Designing a User Interface (15 minutes) Delivery Tip The instructions are deliberately somewhat vague so that students can ... Ferguson and Bardell, Inc case study, focusing on the section titled "Time Sheet System." Consider the activity of time reporting as performed by the consultant Design a user interface for that activity...
- 4
- 375
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
Ngày tải lên :
20/02/2014, 23:20
... of ATP (0.5–1 mM) for maximal activity Narasimhan and Attardi [41] showed that a high concentration of 5¢-adenylylimidodiphosphate was able to stimulate the Ó FEBS 2003 878 C Vijayasarathy et al ... mitochondrial functions during hypoxia and a compensatory up-regulation of alternate energy generating systems Discussion Studies in yeast have demonstrated that oxygen acts as a molecular switch and alters ... indicated in the Materials and methods section Values are given as means ± SD calculated from four estimates Macrophages Normoxia Total cellular ATP (nmolÆmg protein)1) Respiration coupled ATP synthesis...
- 9
- 554
- 0
Báo cáo khoa học: All-trans-retinoic acid inhibits collapsin response mediator protein-2 transcriptional activity during SH-SY5Y neuroblastoma cell differentiation pptx
Ngày tải lên :
16/03/2014, 12:20
... regulates polarized Numb-mediated endocytosis for axon growth Nat Cell Biol 5, 819–826 10 Arimura N, Menager C, Kawano Y, Yoshimura T, Kawabata S, Hattori A, Fukata Y, Amano M, Goshima Y, Inagaki ... Ohshima T, Sasaki Y, Suzuki H, Yanai S, Yamashita N, Nakamura F, Takei K, Ihara Y, Mikoshiba K et al (2005) Semaphorin 3A signalling is mediated via sequential Cdk5 and GSK3beta phosphorylation ... Transcriptional regulation of CRMP-2 neuronal cell differentiation that could be implicated in its transcriptional regulation, such as Sp1, AP-2, E2F, Pax-3 and NeuroD1 Typical TATA and CAAT boxes were also...
- 14
- 248
- 0
Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx
Ngày tải lên :
30/03/2014, 08:20
... DNA polymerase activity A S Roy et al M13 mp 18 (+) ss DNA template MCS EcoR1 Sac1 Xma1 BamH1 Xba1 Kpn1 Sma1 Acc1 HincII Sal1 Pst1 Sph1 HindIII ATGACCATGATTACGAATTCCGAGCTCGGTACCCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT ... 32p-GTTTTCCCAGTCACGAC 3’ 17-mer M13 Univ primer (-20 downstream oligo) Gap-3/OH 3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGGTTCGAACGTACGGACGTCCA…5’ 5’ 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT 3’ ... extract prepared from mungbean seeds at different daf stages at °C for h with shaking DNA polymerase activity assay was then carried out at 37 °C for 45 using activated calf thymus DNA as template...
- 19
- 350
- 0
Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot
Ngày tải lên :
31/03/2014, 21:21
... radioactivity covalently attached to DNA polymerases was an indicator of the polymerase activity and was measured after SDS/PAGE by autoradiography Separate results are shown in Fig 2C for DNA ... polymerase a by poly(b-Lmalate) in the nuclear extract (d) The activity was measured as a function of added amounts of DNA polymerase a in the standard DNA polymerase assay that contained the extract ... bovine serum albumin, and DNA polymerase After a 30-min lcubation at 37 °C, 10% (v/v) saturated cold trichloroacetic acid in water was added and the precipitate collected on Whatman GF/C filters,...
- 6
- 347
- 0
báo cáo hóa học: " Identification of symptom domains in ulcerative colitis that occur frequently during flares and are responsive to changes in disease activity" ppt
Ngày tải lên :
18/06/2014, 19:20
... Demographics and disease characteristics of patients in the study Characteristics Gender Male Female Median [range] age (years) NIH Race Caucasian Asian or Pacific Islander Black American Indian/Alaskan ... Visual analogue scale ratings of symptoms that are absent during remission A box plot of the VAS ratings of symptoms that are absent during remission All of the symptoms evaluated had VAS ratings ... criteria for defining a frequent and responsive symptom domain specifically stated that all three endpoints for a particular symptom domain had to have a median VAS rating that was significantly...
- 12
- 382
- 1
báo cáo hóa học: " Kinematics and muscle activity of individuals with incomplete spinal cord injury during treadmill stepping with and without manual assistance" docx
Ngày tải lên :
19/06/2014, 10:20
... amplitudes An alternative possibility is that manual assistance provides more normative kinematic patterns, resulting in more appropriate sensory feedback and increasing EMG amplitudes We examined ... walk at faster speeds with manual assistance than without The average highest walking speed without manual assistance was 0.76 m/s The average walking highest speed with manual assistance was ... spinal cord injury walk at faster speeds than they could without assistance In addition, manual assistance helps to keep the muscle activation patterns more similar to control data when walking at...
- 14
- 434
- 0
báo cáo hóa học:" Effect of shoe heel height on vastus medialis and vastus lateralis electromyographic activity during sit to stand" pdf
Ngày tải lên :
20/06/2014, 01:20
... ARV data for VM and VL, and the data for the VM: VL ratio were all tested for statistical significance For each of these variables, a × repeated measures analysis of variance (ANOVA) was carried ... calculate the ratio of VM: VL EMG activity for each condition Statistical analysis Data were analysed using the Statistical Package for Social Sciences (SPSS) version 11.5 The separate EMG ARV ... 78:25-32 Janwantanakul P, Gaogasigam C: Vastus lateralis and vastus medialis obliquus muscle activity during the application of inhibition and facilitation taping techniques Clinical Rehabilitation...
- 7
- 447
- 0
báo cáo hóa học:" Does a SLAP lesion affect shoulder muscle recruitment as measured by EMG activity during a rugby tackle?" potx
Ngày tải lên :
20/06/2014, 04:20
... humeral head Any delay in the activity of Serratus Anterior could impair scapular control e.g lateral (upward) rotation and protraction This would allow the humeral head to translate anteriorly and ... demonstrate that both Infraspinatus and Subscapularis contracted during mid range elevation to produce glenohumeral stability, and the work of Oveson and Nielson [66] who stated that Infraspinatus ... identified a delay in activation of Serratus Anterior, in painful unstable shoulders, this study indicates that facilitation of the Serratus Anterior may not be necessary in the case of rugby players...
- 10
- 233
- 0
báo cáo hóa học:" Physical activity and change in quality of life during menopause- an 8-year follow-up study" docx
Ngày tải lên :
20/06/2014, 16:20
... Physical activity and change in quality of life during menopause –an 8-year followup study Jaana M Moilanen1, Anna-Mari Aalto2, Jani Raitanen1,3, Elina Hemminki2, Arja R Aro4, Riitta Luoto3,5 ... authors: JMM: jaana.m.moilanen@uta.fi AMA: anna-mari.aalto@thl.fi JR: jani.raitanen@uta.fi EH: elina.hemminki@thl.fi ARA: araro@health.sdu.dk RL: riitta.luoto@uta.fi Correspondence to: Riitta Luoto ... statistical packages Results At baseline the mean age of the study sample was 47.0 years and in 2008 it was 56.0 years The proportion of women reporting at least moderate physical activity (at...
- 20
- 306
- 0
Another word a day part 19 ppt
Ngày tải lên :
07/07/2014, 12:20
... (BART) trains,“Humphrey Go Bart”? —Martin A David, Santa Clara, California cinematheque (sin-uh-muh-TEK) noun A small theater showing experimental, artistic, or classic films From French cinémathèque ... the Australian Manufacturing Union—you’d think Qantas is a certain winner in the only market that matters: domestic.” —Australian (Sydney) There Really Was a Tin Ear Years ago, ear trumpets were ... term from a shaggy-dog story where a train passenger is carrying a large, oddly shaped package The passenger calls it a MacGuffin and explains to his curious fellow passengers that it’s a device...
- 10
- 198
- 0
Báo cáo lâm nghiệp: "Limitation of photosynthetic activity by CO 2 availability in the chloroplasts of oak leaves from different species and during drought" pdf
Ngày tải lên :
08/08/2014, 18:21
... Nevertheless, a colimitation by c and biochemical factors cannot be ruled out, and additionnal data are needed to clarify this point Second, what is the for such a drought, and showed that an accurate ... assimilation rates among C species may also be partly explained by variable CO availability (Loreto et al, 1992; Epron et al, 1995) rather than solely by the biochemical limitations put forward ... here, and also lower than values measured in poplar leaves (0.66) results confirmed that in decreases of net assimilation rates associated to decreasing c , despite the apparent maintenance and...
- 12
- 346
- 0
Báo cáo y học: " Foot posture influences the electromyographic activity of selected lower limb muscles during gait" doc
Ngày tải lên :
10/08/2014, 21:24
... coverage angle; talus second metatarsal angle A - calcaneal inclination angle, B - calcaneal-first metatarsal angle, C - talo-navicular coverage angle, D - talus-second metatarsal angle Angle A ... angular measurements obtained from antero-posterior and lateral x-rays (talus-second metatarsal angle, talonavicular coverage angle, calcaneal inclination angle and calcaneal-first metatarsal angle) ... 0.11** AI arch index, NNHt normalised navicular height truncated, CIA calcaneal inclination angle, C1MA calcaneal first metatarsal angle, TNCA talo-navicular coverage angle, T2MA talus-second...
- 9
- 322
- 0