5 pecvd of sio2 in a 3d icp reactor

Curcumin potentiates antitumor activity of 5-fluorouracil in a 3D alginate tumor microenvironment of colorectal cancer

Curcumin potentiates antitumor activity of 5-fluorouracil in a 3D alginate tumor microenvironment of colorectal cancer

... of individual and combined 5-FU and curcumin treatments The cells were maintained in tissue culture flasks in growth medium and in a humidified incubator at 37°C in an atmosphere of 95% air and ... metastasis-associated signaling protein expression profiles in 3D spheroids within alginate beads, in migrated (invaded) and in adherent cells was investigated We examined tumor metastasis promoting ... incubator at 37°C with 5% CO2 in air Phase contrast of alginate bead cultures In order to investigate the behavior and vitality of CRC cells in alginate bead culture, whole alginate beads left untreated,

Ngày tải lên: 29/09/2020, 15:58

15 19 0
Volume 5 biomass and biofuel production 5 17 – use of biofuels in a range of engine configurations

Volume 5 biomass and biofuel production 5 17 – use of biofuels in a range of engine configurations

... oil preheated to 75 °C [59], with a particularly dramatic reduction of 34% in HC emissions Canakci et al [59] and Agarwal and Agarwal [58] also declared that sunflower oil and Jatropha can be directly ... crude palm oil Automobile Engineering 216(D1): 785–792 [58] Agarwal D and Agarwal AK (2007) Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection ... while inedible oils are used mainly in Asia Compared to animal fat and waste grease, vegetable oils are cleaner and well suited for producing high-quality biodiesel, as additional after-treatments

Ngày tải lên: 30/12/2017, 18:08

14 209 0
Therapy response testing of breast cancer in a 3D high-throughput perfused microfluidic platform

Therapy response testing of breast cancer in a 3D high-throughput perfused microfluidic platform

... data and in writing the manuscript Page 10 of 11 10 Availability of data and materials The datasets supporting the conclusions of this article are included within the article and its additional ... screen and detect inter-individual heterogeneity of paracrine interactions between T47D breast carcinoma cells and breast carcinoma-associated fibroblasts of various grades or normal mammary fibroblasts ... KW, Friedl A, et al Transition to invasion in breast cancer: a microfluidic in vitro model enables examination of spatial and temporal effects Integr Biol [Internet] 2011;3:439–50 Available from:

Ngày tải lên: 06/08/2020, 04:34

11 23 0
A study of vocabulary teaching techniques used by grade 5 teachers of english at a primary school in phu tho

A study of vocabulary teaching techniques used by grade 5 teachers of english at a primary school in phu tho

... The importance of vocabulary in teaching and learning English 1.1.4 Aspects of teaching vocabulary 1.2 Vocabulary teaching techniques .11 1.2.1 Stages of teaching vocabulary ... separated from teaching vocabulary In recent years, vocabulary has been considered as a center stage in teaching English Vocabulary teaching techniques have become the main focus of linguists and ... 3.2.3 Teacher Using of translation, chants and realia are vocabulary teaching techniques that are applied by teacher • Using of translation Teacher used this technique when teaching “Unit 15- Lesson

Ngày tải lên: 30/09/2020, 12:22

58 12 0
longitudinal label free quantitative tracking of cell death and viability in a 3d tumor model with oct

longitudinal label free quantitative tracking of cell death and viability in a 3d tumor model with oct

... models are of particular significance in studies of therapeutic response in ovarian cancer as their size and complexity are similar to that of ovarian metastatic lesions Metastatic ovarian cancer ... capable of carrying out high-content, longitudinal assays of 3D culture treatment response We demonstrate the usage and capability of OCT for the dynamic monitoring of individual and combination ... viability assays failed OCT 3D viability imaging revealed synergy between PDT and the standard-of-care chemotherapeutic carboplatin that evolved over time We believe the efficacy and accuracy of

Ngày tải lên: 04/12/2022, 15:04

11 0 0
a study on awareness and implementation of csr in a multinational companies operating in vietnam

a study on awareness and implementation of csr in a multinational companies operating in vietnam

... this area. Besides, the objective understands awareness and implementation, CSR reporting of CSR in a multinational company operating in Vietnam by asking respondents' understanding and ... Monetary Fund APEC Asia - Pacific Economic Cooperation ASEM Asia - Europe Meeting VCCI Chamber of Commerce and Industry of Vietnam OSHA Occupational Safety and Health Administration ... and social 4 The last lesson was...List of Abbreviations CSR Corporate Social Responsibility WTO World Trade Organizations ASEAN Association of Southeast Asian Nations IMF International

Ngày tải lên: 13/03/2014, 14:19

91 795 1
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

... TRAF1 were designated HeLaTR/4-1BB and HeaLaTR/ TRAF1, respectively. Primers for amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... of the primers used for amplifying the hTRa1 cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGG AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢.In order to overexpress 4-1BB and TRAF1 ... Kamakura Research Laboratories, Chugai Pharmaceutical Co. Ltd, 200 Kajiwara, Kamakura, Kanagawa, 247-8530, Japan. Fax: + 81 467 45 6782, Tel.: + 81 467 45 4382, E-mail: okabehsf@chugai-pharm.co.jp Abbreviations:

Ngày tải lên: 23/03/2014, 18:20

10 491 0
Giáo trình thực hành BCMSN   Chương 7 – Planning for Implementation of Voice in a Campus

Giáo trình thực hành BCMSN Chương 7 – Planning for Implementation of Voice in a Campus

... SW2950_02 (config-vlan)#name VLAN20 SW2950_02 (config-vlan)#vlan 40 SW2950_02 (config-vlan)#name VLAN40 SW2950_02 (config-vlan)#end Cấu hình VLAN trên SW3560_01 SW3560_01(config-vlan)#name ... (config-vlan)#end Cấu hình VLAN trên SW2950_02 SW2950_02 (config-vlan)#name VLAN20 SW2950_02 (config-vlan)#vlan 40 SW2950_02 (config-vlan)#name VLAN40 SW2950_02 (config-vlan)#end Cấu hình VLAN ... hình VLAN trên SW2950_01 SW2950_01 (config-vlan)#name VLAN20 SW2950_01 (config-vlan)#vlan 40 SW2950_01 (config-vlan)#name VLAN40 SW2950_01 (config-vlan)#end Cấu hình VLAN trên SW2950_02

Ngày tải lên: 08/05/2014, 13:41

12 457 0
Báo cáo sinh học: " Comparative genomics of Bacillus thuringiensis phage 0305φ8-36: defining patterns of descent in a novel ancient phage lineage" docx

Báo cáo sinh học: " Comparative genomics of Bacillus thuringiensis phage 0305φ8-36: defining patterns of descent in a novel ancient phage lineage" docx

... size of a connector dropping below the chain of matches indicates the amount of DNA missing in BtI1 versus 0305φ8-36. A triangle above the chain of matches indicates the amount of DNA in BtI1 in ... ancestor to 0305φ8-36. Phage 0305 φ 8-36 has a two-gene form of the tail chaperonin Many tailed phages have a tail chaperonin produced by a programmed translational frameshift within a pair of ... attached to it. These N and C-terminal domains in 0305φ8-36 gp147 are recog- nized by a Pfam search as cell wall degradative domains. Gp147 has an N-terminal transglycosylase domain, and C-terminal

Ngày tải lên: 18/06/2014, 18:20

17 293 0
Báo cáo hóa học: " Comparative genomics of Bacillus thuringiensis phage 0305φ8-36: defining patterns of descent in a novel ancient phage lineage" potx

Báo cáo hóa học: " Comparative genomics of Bacillus thuringiensis phage 0305φ8-36: defining patterns of descent in a novel ancient phage lineage" potx

... size of a connector dropping below the chain of matches indicates the amount of DNA missing in BtI1 versus 0305φ8-36. A triangle above the chain of matches indicates the amount of DNA in BtI1 in ... ancestor to 0305φ8-36. Phage 0305 φ 8-36 has a two-gene form of the tail chaperonin Many tailed phages have a tail chaperonin produced by a programmed translational frameshift within a pair of ... attached to it. These N and C-terminal domains in 0305φ8-36 gp147 are recog- nized by a Pfam search as cell wall degradative domains. Gp147 has an N-terminal transglycosylase domain, and C-terminal

Ngày tải lên: 20/06/2014, 01:20

17 263 0
báo cáo hóa học: " Single-step processing of copper-doped titania nanomaterials in a flame aerosol reactor" ppt

báo cáo hóa học: " Single-step processing of copper-doped titania nanomaterials in a flame aerosol reactor" ppt

... NANO EXPRESS Open Access Single-step processing of copper-doped titania nanomaterials in a flame aerosol reactor Manoranjan Sahu and Pratim Biswas * Abstract Synthesis and characterization of ... dopant concentrations (A anatase, R rutile). (b) Comparison of the XRD anatase peaks of Cu-TiO 2 nanoparticles: anatase (101) peaks and (c) anatase (201) peaks (test 1). Sahu and Biswas Nanoscale ... of the burner. The bubbler containing the liquid TTIP precursor was placed in an oil bath and was maint ained at a temperature of 98°C. The precursor delivery tube was maintained at a temperature

Ngày tải lên: 21/06/2014, 02:20

14 407 0
Báo cáo hóa học: " Research Article Adaptive Probabilistic Tracking Embedded in Smart Cameras for Distributed Surveillance in a 3D Model" doc

Báo cáo hóa học: " Research Article Adaptive Probabilistic Tracking Embedded in Smart Cameras for Distributed Surveillance in a 3D Model" doc

... localization visualization of all your buddies instead of just a binary online/away classification Additionally, an idea is that available navigation software could be used on top of this to allow ... distributed camera system is presented 1.1 Related work 1.1.1 Smart cameras A variety of smart camera architectures designed in academia [4, 5] and industry exist today What all smart cameras share is ... tracking data, and takes care of person handover 3.2.1 Background modeling and autoinit In contrast to Section 2, we take advantage of the fact that each camera is mounted statically This enables

Ngày tải lên: 22/06/2014, 22:20

17 436 0
Quiet, the power of introverts in a world that cant stop talking   susan cain

Quiet, the power of introverts in a world that cant stop talking susan cain

... ran a story about a woman who was afraid... plodding on as a mathematician would calculate the distance of the Moon from the Earth,” complained a religious newspaper in 1837 As ... presidential campaign pitted a former Harvard professor, John Quincy Adams,... feel insecure?” inquired the cover of Adler’s best-selling book, Understanding Human Nature “Are you fainthearted? Are ... senior lawyer she’d been working with went on vacation, leaving her in charge of an important negotiation The client was a South American manufacturing company that was about to default

Ngày tải lên: 27/07/2014, 07:49

243 804 2
Báo cáo lâm nghiệp:" Dynamics of litterfall in a chronosequence of Douglas-fir (Pseudotsuga menziesii Franco) stands in the Beaujolais mounts (France)" potx

Báo cáo lâm nghiệp:" Dynamics of litterfall in a chronosequence of Douglas-fir (Pseudotsuga menziesii Franco) stands in the Beaujolais mounts (France)" potx

... Plantation Plantation Plantation Plantation 9 22 30 42 42 49 73 95 Natural Natural Natural Natural Plantation.. .Dynamics of litterfall in Douglas-fir Figure 5 Continued 485 486 J Ranger ... on a Visean compact volcanic tuff rich in alkaline and earth alkaline elements i.e. 2% CaO and 1.9% MgO. Par- ent material weathering was mainly associated to dissolution proc- esses, leading ... database is presented in Annex I. 2.7. Statistical data processing Elementary statistics and analysis of variance were operated using the UNISTAT statistical package (v. 5.0) in order to compare

Ngày tải lên: 08/08/2014, 01:21

14 288 0
Báo cáo y học: "First somatic mutation of E2F1 in a critical DNA binding residue discovered in well- differentiated papillary mesothelioma of the peritoneum" doc

Báo cáo y học: "First somatic mutation of E2F1 in a critical DNA binding residue discovered in well- differentiated papillary mesothelioma of the peritoneum" doc

... CA) Chromatograms were analyzed by SeqScape V2.5 and manual review The validation PCR primers are listed below E2F1_ F: 5' GCAGCCACAGTGGGTATTACT 3' E2F1_ R: 5' GGGGAGAAGTCACGCTATGA 3' TRAF7_F ... association domain family 1A ; Rb : retinoblastoma protein 1 ; SIRT1 : sirtuin 1... blue Again the Arginine-Arginine conservation across the E2F family is clearly shown Figure 4: Visualization ... R166 as one of four Arginine residues contacting the DNA target (Figure 4, bottom). Since the crystal structure for the DNA binding domain of E2F4 was available, computational modeling of the

Ngày tải lên: 09/08/2014, 23:20

40 426 0
báo cáo khoa học:" The relationship of oral health literacy with oral health-related quality of life in a multi-racial sample of low-income female caregivers" docx

báo cáo khoa học:" The relationship of oral health literacy with oral health-related quality of life in a multi-racial sample of low-income female caregivers" docx

... visual methods, and was quantified using Spearman’s rho and zero-inflated negative binomial modeling. Results: The study group included a substantial number of African Americans (AA=41%) and American ... Linking clinical variables with health- related quality of life A conceptual model of patient outcomes JAMA 1995,... JAMA 1995, 273:59-65 6 Brennan DS, Spencer AJ: Mapping oral ... Indian (AI) female caregivers, whose primary language was English (N=1,278). Variable Measurements Additional demographic characteristics included age and education. Age was measured in years

Ngày tải lên: 11/08/2014, 23:22

29 216 0
Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx

Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx

... Saumya Ramanayake (saumya1025@gmail.com) Marina Alexander (marina.r.alexander@gmail.com) Nitasha Kumar (nakum1@student.monash.edu) Gabriela Khoury (gabriela.khoury@monash.edu) Candida Pereira ... and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cells. Suha Saleh 1,2 , Fiona Wightman 1,2 , Saumya Ramanayake 1 , Marina Alexander 3 , Nitasha ... s.lewin@alfred.org.au or sharon.lewin@monash.edu Email addresses: SS: suha.saleh@med.monash.edu.au FW: fiona.wightman@monash.edu SR: saumya1025@gmail.com MRA: marina.r.alexander@gmail.com NK: nakum1@student.monash.edu

Ngày tải lên: 13/08/2014, 01:21

31 268 0
Báo cáo y học: "On the threshold - evaluation of variability in effects of acupuncture in a gender perspective" doc

Báo cáo y học: "On the threshold - evaluation of variability in effects of acupuncture in a gender perspective" doc

... of the joint distribution of the paired data (Figure 5) is required for taking account o f the individual var- iation in the pain data. Themeasureoftheindividualchanges,therelative rank variance ... (3) after EA for 20 minutes and (4) 10 minutes after ended EA. Statistical analysis The age of the participants was presented as mean and standard deviation (SD). The data of the assessed EST and ... sensation and pain [18]. As pain is subjective, the data of pain have non-metric ordinal properties. The ordinal data do not indicat e the magnitude and distance between categories of the assessment instrument

Ngày tải lên: 13/08/2014, 14:20

10 285 0
Immersive simulation games a case study of learning in a 3d multi user virtual environment

Immersive simulation games a case study of learning in a 3d multi user virtual environment

... virtual representations in digital games are also known as the avatars, often referred to as a personal digital and graphical representation of their real self Celia Pearce inferred that in games, ... even voice of the virtual graphical appearance of avatars It was argued that such social factors of CMC played a more substantial role in the factors influencing “trust, attraction and friendships” ... on a private simulator of NUS, 65, 536 square metres in size, capable of supporting up to 15, 000 3D prims As the flying height limit of all avatars in SL is set at 4096m, avatars in the simulation...

Ngày tải lên: 02/10/2015, 17:14

106 414 0
A case study of learning in a 3d multi user virtual environment

A case study of learning in a 3d multi user virtual environment

... virtual representations in digital games are also known as the avatars, often referred to as a personal digital and graphical representation of their real self Celia Pearce inferred that in games, ... even voice of the virtual graphical appearance of avatars It was argued that such social factors of CMC played a more substantial role in the factors influencing “trust, attraction and friendships” ... on a private simulator of NUS, 65, 536 square metres in size, capable of supporting up to 15, 000 3D prims As the flying height limit of all avatars in SL is set at 4096m, avatars in the simulation...

Ngày tải lên: 09/10/2015, 11:06

106 458 0
w