5 3 6 device programming and testing

Ngày tải lên: 21/12/2013, 19:15

Ngày tải lên: 21/12/2013, 19:15

... 52 1 52 3 52 4 52 4 52 7 52 9 53 1 53 3 53 5 53 7 53 9 53 9 54 0 54 1 54 2 54 3 54 4 54 5 54 5 54 5 54 9 55 0 55 1 55 3 55 3 55 4 55 5 55 6 13 Digital functions 55 8 13. 1 General ... 57 2 57 3 57 4 57 4 57 6 57 6 57 8 57 8 57 9 58 0 58 0 58 1 58 2 58 3 58 6 58 6 59 1 59 2 59 4 59 4 59 6 59 7 59 9 6 03 6 03 6 03 6 05 6 05 606 607 607 609 610 611 612 612 6 15 6 15 6 15 Table of contents 13. 9 .3 Combine strings ... 1 23 1 23 1 25 1 25 126 129 129 129 131 132 132 132 133 133 134 134 134 1 35 1 35 1 35 137 137 138 138 139 139 140 141 142 1 43 Program execution 144 5. 1...

Ngày tải lên: 26/11/2014, 07:55

... have literature? S2: On Tuesday, and Friday Unit 5: Lesson 6: C2 -3/ p .59 WRITE IT UP - We have Math on , .and - We have History on Unit 5: Lesson 6: C2 -3/ p .59 Summary * Vocabulary: Monday, ... prepersition “ on” with the days of the week Unit 5: Lesson 6: C2 -3/ p .59 VI Homework: + Learn by heart model sentences and vocabulary + Do Ex C .3, 4 / P .51 -52 (Ex-book) ... math Ba: We have it on ……… , ………… and Monday Wednesday Friday ……… Friday Nga: Does Lan have math on ……… ? No, she doesn’ t Ba:……………… Unit 5: Lesson 6: C2 -3/ p .59 Model sentences - When we have...

Ngày tải lên: 23/06/2013, 01:26

... 45 80- (4. 25 – 3. 8) 2448: [119 – ( 23 -6)] + (51 - 49) [ 157 0 – 4.( 25. 19 – 25 9)] : [2 (27- 8)] 2x17x16 +36 x21+8x4x62 32 x 25+ 32 x 75+ 68x79+68x21 d) 231 – (x -6) = 133 9 : 13 e) [(6.x - 39 ) : 3] 79 =3 95 ... (4. 25 – 3. 8) b) 80 - (4. 25- 7.8) f) 2448: [119 – ( 23 -6)] + (51 - 49) c) 23. 75+ 25. 23 +180 g) [ 157 0 – 4.( 25. 19 – 25 9)] : [2 (27- 8)] d) 80- (4. 25 – 3. 8) h) 2x17x16 +36 x21+8x4x62 i) 32 x 25+ 32 x 75+ 68x79+68x21 ... = 7.4 d) 231 – (x -6) = 133 9 : 13 b) (x + 4) = 121 – 7 .3 e) [(6.x - 39 ) : 3] 79 =3 95 c) (5x – ).2 =60 C©u (1 ®iÓm) TÝnh tæng: a) A=1+2 +3+ 4+ +100 b) B = + 10 + 15 +– + 19 95 + 2000 + 20 05 BÀI KIỂM...

Ngày tải lên: 14/09/2013, 14:10

... ĐỘNG CỦA HS - HS đọc thơ + Từ “ chân , giải thích NỘI DUNG GHI I/ Từ nhiều nghĩa * Ngữ liệu ( SGK /55 ) - Bài thơ : “ Những chân ” VD : “ mắt ” : + Bạn Hiền có đôi mắt bồ câu đẹp + Những na bắt ... nghe – viết theo yêu cầu SGK /57 ( ý phụ âm : l/n ; s/x ; tr/ch  Rút kinh nghiệm: TUẦN :5 TIẾT: 20 Ngày soạn: 10/ 9/2009 ... Kiểm tra cũ: đoạn văn tự Bài mới: * HĐ 1: Hướng dẫn HS tìm hiểu qua Lời văn giới phần I ( SGK / 58 ; 59 ) thiệu nhân vật - HS đọc2 đoạn văn - HS đọc , suy nghĩ , trả lời câu ...

Ngày tải lên: 19/09/2013, 21:10

... phải theo qui trình, kĩ thuật 2/ Học sinh nhắc lại học 3/ Giáo viên cho học sinh quan sát lại mẫu hình gấp học 4/ Kiểm tra đồ dùng, vật liệu HS 5/ HS thực hành gấp, cắt, dán sản phẩm học chương I ... hướng dẫn HS cách dán hoa trang trí sản phẩm (HS trang trí sản phẩm theo ý thích riêng) • Hoạt động 3: HS thực hành nháp - Chia lớp theo dãy bàn - Mỗi dãy chọn cử HS lên gấp, cắt dán hoa cánh, cánh, ... Cả lớp quan sát - nhận xét - Dặn dò chuẩn bị tiết thực hành Thứ tư ngày 27 tháng 10 năm 2010 Bài 5: GẤP, CẮT, DÁN BÔNG HOA Tuần : (Tiết 2) • Hoạt động 1: Kiểm tra thao tác kĩ thuật - Gv treo tranh...

Ngày tải lên: 25/09/2013, 14:10

... choices and the features or factors that were compared, such as number of ports, features, price, performance, and so on 2-2 CCNA 1: Networking Basics v 3. 0 - Lab 5. 1.6 Copyright  20 03, Cisco...

Ngày tải lên: 19/10/2013, 02:15

... business objects, services, and attributes that may not have been explicitly listed in the usage scenario Activity 5. 3: Identifying Attributes and Relationships 35 Exercise 2: Identifying Business ... 34 Activity 5. 3: Identifying Attributes and Relationships Exercise 1: Identifying Business Object Attributes ( 20 minutes) ... logical model of one aspect of the solution indicating the business objects, their attributes and services, and the relationships among the business objects After completing the above steps, you will...

Ngày tải lên: 10/12/2013, 16:16

... Centre router: Centre(config)#interface loopback0 Centre(config-if)#ip address 172.16.1.1 255 . 255 . 255 . 255 Note: If 172.16.1.1 is pinged from the Centre console, the loopback interface replies b ... default information in IGRP On Centre, issue the following commands: 3- 6 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 7 .3. 6 Copyright  20 03, Cisco Systems, Inc Centre(config)#router igrp 24 Centre(config-router)#network ... 10.0.0.0/8 and no route to 0.0.0.0/0, why does this ping succeed? _ 4-6 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 7 .3. 6 Copyright  20 03, Cisco Systems,...

Ngày tải lên: 21/12/2013, 19:15

... NDT2 95, 37 13, 74% 45, 49% $161,00 9,98% NDT3 35 , 95 13, 74% 45, 49% $1 83, 12 9,98% NDT382,10 13, 74% 45, 49% $208,28 9,98% NDT 434 ,59 13, 74% 45, 49% $ 236 ,89 9,98% NDT494,29 13, 74% 45, 49% $269, 43 9,98% NDT 554 ,04 ... NDT 554 ,04 12,09% 47,42% $291 ,34 9,98% NDT611,90 10,44% 49 ,34 % $30 9,99 9,98% NDT6 65, 71 8,79% 51 ,26% $32 4, 45 9,98% NDT7 13, 29 7, 15% 53 ,19% $33 3,92 9,98% NDT 752 , 53 5, 50% 55 ,11% $33 7,81 9,98% Giá trị FCFE ... 1,0998 1,2096 1 ,33 03 1,4 630 1,6090 1,7696 1,9462 2,14 05 2, 35 4 1 2 ,58 90 Giá trị NDT146 ,39 NDT 151 ,40 NDT 156 ,57 NDT161,92 NDT167, 45 NDT164,64 NDT 159 ,28 NDT 151 ,58 NDT141, 85 NDT 130 ,48 NDT 1 53 1 , 53 Để ước lượng...

Ngày tải lên: 16/01/2014, 11:37

... 48 16 32 6 Shielded Shielded 5e 5e 5e 5e 5e 1 1 RJ 45 coupler panel Catalog Number ADCPP24606 ADCPP48606 ADCPP24RJ6-S ADCPP24RJ5E-S ADCPP2 450 5 ADCPP4 850 5 ADCPP16KSRJRJ ADCPP32KSRJRJ RJ 45 coupler ... pairs ordered separately 14. 75" x 10. 75" x 5. 25" (37 4.7mm x 2 73. 1mm x 133 .4mm) 6642 3 15- 04 30 0-pair, 5- pair color-coded kit Includes (12) 25- pair FT blocks with 5- pair code marked on face of ... 9. 63" x 4.88" x 3. 69" (244.5mm x 1 23. 8mm x 93. 7mm) 6 637 150 -60 200-pair preterminated to (8) 25- pair female telco (RJ-21X) connectors 18.44" x 4.88" x 3. 69" (468.0mm x 1 23. 8mm x 93. 7mm) 6 637 ...

Ngày tải lên: 24/01/2014, 11:20

... JCC 151 .6 43. 0 39 .1 (2¢) JCP INADEQUATE 13 C-TOCSY 2¢ 2¢ ,3 ,4¢ ,5 71.2 40 .5 (1¢ ,3 ) 1¢ 72.7 41.6 (2¢,4¢) 71.7 41.6 (3 ) 5. 1 5 40.2 (5 ) 65. 0 40.6 (4¢) 4 .5 4¢ 1¢ ,3 ,4¢ ,5 1¢,2¢,4¢ ,5 1¢,2¢ ,3 ,5 ... [2,1¢,2¢ ,3 ,4¢ ,5 -13C6]-2 ,5- diamino-6-ribitylamino-4(3H)-pyrimidinone 5 -phosphate (compound 5) using D2O as solvent Chemical shift (p.p.m.) Carbon atom H 1¢-proS 1¢-proR 2¢ 3 4¢ 3. 30 3. 46 3. 77 3 .55 3. 70 5 3. 74 13 ... nucleotide reduction in fungi and archaea W Romisch-Margl et al ¨ 13 Fig Time-resolved 13C-NMR signals A mixture of [2,1¢,2¢ ,3 , 4¢ ,5 -13C6]-3a and [2,1¢,2¢ ,3 ,4¢ ,5 -13C6]-3b was generated by incubation...

Ngày tải lên: 18/02/2014, 18:20

... 1 53 Using the Validation Controls 2 23 Database Design and Development 259 Speaking SQL 30 3 ADO.NET 34 3 10 Displaying Content Using Data Lists 4 13 11 Managing ... Grid View and Details View 441 12 Advanced Data Access 4 83 13 Security and User Authentication 54 5 14 Working with Files and Email 59 1 15 ASP.NET AJAX 631 A Web Control ... Build Your Own ASP.NET 3 .5 Web Site Using C# & VB (www.sitepoint.com) 224 224 228 234 2 35 236 238 240 241 2 45 xiii Validation Groups ...

Ngày tải lên: 08/03/2014, 20:20

... reached and then quits: weerapan weerapan ttyq6 ttyq6 132 .162 .32 .37 132 .162 .32 .37 Mon Feb 15 19:07 - 19:21 Mon Feb 15 19:07 - 19:21 (00: 13) (00: 13) interrupted at Mon Feb 15 19:07 :52 19 93 3.1 Flags ... 17 :39 17 :38 17 :34 17 :34 17 :33 17: 25 17:22 17:19 17:14 still - 17 :39 still still still - 17 :36 - 17:26 - 17:26 still still logged in (00:00) logged in logged in logged in (00: 03) (00:01) (00: 03) ... kernel’s version and configuration: Linux kernels 2.6.7 and earlier write a v0 format acct file which unfortunately cannot store user and group ids (uid/gid) larger than 655 35 Kernels 2.6.8 and later...

Ngày tải lên: 23/03/2014, 00:20

... time Object Oriented Programming with C++ / Session / 34 of 44 Dynamic binding (Contd.) Requires some overhead in processing but provides increased power and flexibility in programming s Dynamic ... Beta::display(); } • The compiler is able to detect the name clashes and resolves it Object Oriented Programming with C++ / Session / 13 of 44 Multiple Inheritance: Common Base s s There are many combinations ... Oriented Programming with C++ / Session / 14 of 44 Common Base s Both Teacher and Student contain a copy of the Person class members • When Teaching assistant is derived from both Teacher and Student...

Ngày tải lên: 23/03/2014, 04:21

... intmat intmat intmat intmat >> repmat(intmat ,3, 2) ans = 50 34 50 96 59 96 50 34 50 96 59 96 50 34 50 96 59 96 intmat intmat 34 59 34 59 34 59 2.1 .5 Empty Vectors An empty vector (a vector that ... the following creates 35 36 CHAPTER 2: Vectors and Matrices a vector with five values linearly spaced between and 15, including the and 15: >> ls = linspace (3, 15, 5) ls = 12 15 Similarly, the logspace ... Is fix (3 .5) the same as floor (3 .5) ? n Is fix (3. 4) the same as fix( -3. 4)? n Is fix (3. 2) the same as floor (3. 2)? n Is fix( -3. 2) the same as floor( -3. 2)? n Is fix( -3. 2) the same as ceil( -3. 2)? For...

Ngày tải lên: 23/03/2014, 15:53

... and methods DNA constructs Coding sequences of mouse copines-2 and -6, and human copines-1, -3 and –7, were derived from image clones: IMAGE :39 859 59, IMAGE: 659 10 63, IMAGE: 35 0 2122, IMAGE : 53 0 0 53 0 ... CCTGAAGCCTGGGGGGCCTGTGCAG -3 , EcoRI– AgeI; copine-2–EYFP: 5 -CCAGATCTCCATGGCCTAC ATTCCGGATGGG -3 and 5 -CCCTCGAGGGCAGGCT CTGAGTTGGTG -3 , BglII–XhoI; copine -3 EYFP: 5 -GT TTCTCTCGAGGCCGCCACCATGGCTGCCCAGTGTG TCAC -3 and ... City, Hertfordshire, UK; excitation 488nm and emission 53 0 55 0-nm bypass filter, or excitation 54 3- nm and emission 56 0-nm long-pass filter; optical slice, 0.1–0 .3 lm) For live internalization imaging,...

Ngày tải lên: 29/03/2014, 21:20

... Senegal and Burkina Faso Their record id’s are: SE20 030 201004 BF20 030 6 050 02 SE20 030 731 0 05 If ISIS indexes the whole field, the index would be: BF20 030 6 050 02 SE20 030 201004 SE20 030 731 0 05 But by ... made, and not all involve the same amount of work To better understand these capabilities and the work required, let’s design a CDS/ISIS database Database management systems - Textual databases and ... following common features: Handling the structure of textual databases Text-oriented formatting Fast and powerful retrieval ¦pªG¦³¿ ®Ñ© Handling different languages and scripts Let’s review together...

Ngày tải lên: 31/03/2014, 20:20

... you have to: 1) 2) 3) 4) open a text editor (Notebook or Word), or an HTML editor; write a page starting with and ending with ; use commands and scripts; then save ... MySQL, and Access Web Server ODBC (Open Database Connectivity) is a standard SQL API (Application Programming Interface); it is a software layer between your program (e.g CGI, Java, etc.) and a ... At the end of this lesson, you will be able to: • understand what Active Server Pages (ASP) are; and • be aware of the main advantages and disadvantages of ASP Introduction Users will have to...

Ngày tải lên: 31/03/2014, 20:20