... Gratta, Yutaka Sasaki, Jock McNaught, Simonetta Montemagni, Monica Monachini, Nicoletta Calzolari, Sophia Ananiadou, BioLexicon: Towards a Reference Terminological Resource in the Biomedical ... A. C., G Divita, A. R Aronson, and A. T McCray 2003 UMLS Language and Vocabulary Tools In Proc of AMIA Annual Symposium 2003, p.798 Robertson, S.E., Walker S., Jones, S., HancockBeaulieu M.M., and ... retro-regulate This means that derivational relations of retro-regulate are not covered by the Specialist Lexicon 20 adverbal adjetivial Terminologies nominalization adverb adjective noun verb Derivational...
Ngày tải lên: 22/02/2014, 02:20
... sag in Phase A) Phase unbalance (20◦ , −120◦ & −240◦ ) Amplitude & phase unbalance Distorted (15% 3th & 10% 5th order harmonics) Distorted & unbalanced (amplitude & phase) 174 D Sreenivasarao ... transformer DC voltage is maintained across the capacitor of the single -phase APF by using a separate single -phase transformer with a diode rectifier bridge of a very low kilo-Volt Ampere (kVA) ... Yes Better than star-delta and star-hexagon Good Better than star-delta and star-hexagon Good Low High Lowest Highest case under transient as well as abnormal unbalanced utility voltage conditions...
Ngày tải lên: 11/05/2014, 22:06
Topic 5 three phase, four wire systems topic b5
... in each phase using Ohm’s Law Step 2: Convert the power factor for each load into a phase angle Step 3: Draw a scaled phasor diagram (based on V as the A reference phasor) of Currents at their ... 6: Measure and label the phase angle (Ø ) compared to the N reference 20/02/17 Nathan Condie Determining the Neutral Current VC IC in -phase IABC VA (Reference) IA in -phase IN IB in -phase IAB VB ... 5) Phase angle ØN 3Ø, 400 V 20/02/17 Nathan Condie Answer – balanced load VC IC 370 lag VA (Reference) IA 370 lag IB 37 lag IAB VB 20/02/17 Nathan Condie Neutral Current Exercise ANSWER Answers:...
Ngày tải lên: 20/02/2017, 13:04
Design and Implementation of a Three-Phase Induction Motor Control Scheme
... Based on the MATLAB analysis, we get an adequate transient response from this Also, the transient response does not feature rapid, sharp transients of any kind It seems to be a reliable and safe ... between phase A and phase B (VAB = VA – VB) This is because it is connected in a three -phase Y format, this can be seen in Figure 5.5 As a consequence of this, a sinusoidal signal is created (see ... the rotating reference frame, are then converted into three -phase a, b, c values that are referenced in the stationary frame via inverse Clarke and Park transformations The inverse Clarke transform...
Ngày tải lên: 27/10/2013, 23:15
A fuzzy logic CC PWM three phase AC DC converter
... depending on the power term A & that is affected by the factor k Actually, such a factor allows the charge/discharge speed to be controlled A fast dynamic can be generally obtained choosing kS1 in ... controller A conditional integrator, a limited integrator and a tracking anti wind up controller, are commonly used among other solutions However none has faced this problem investigating the actual cause ... would be slow anyway due to the small power factor A faster chargeldischarge process can be achieved with lower CONTROL currents and unity power factor Unfortunately, a large value of k affects the...
Ngày tải lên: 03/01/2014, 19:44
A three phase voltage type PWM rectifier with the function of an active power filter
... reference signal forphase v which is given by (11) can also be obtained in the same manner as that explained above for phase U EXPERIMENTAL INVESTIGATION To confirm the operation of the three -phase PWM ... i,, PWM signals SI,, S, and S , for phase U, phase v and phase w , respectively, are generated as follows: are obtained, which are given by To produce these currents , the rectifier A has to produce, ... -th harmonic component of i,, Though the AC components are also contained in the output signal of the integrator, they can be made small by the integral action of the integrator and by using a...
Ngày tải lên: 03/01/2014, 19:44
Current control techniques for three phase voltage source PWM converters a survey
... IEEE-IAS Annu Meeting, 1992, pp 132–138 T Kawabata, T Miyashita, and Y Yamamoto, “Dead beat control of three phase PWM inverter,” IEEE Trans Power Electron., vol 5, pp 21–28, Jan 1990 A Kawamura, ... Lorenz and D M Divan, “Dynamic analysis and experimental evaluation of delta modulators for field oriented ac machine current regulators,” in Conf Rec IEEE-IAS Annu Meeting, Atlanta, GA, 1987, ... stationary or rotating coordinates [75], [79], [81] The main advantages of DM-CC are extremely simple and tuning-free hardware implementation and good dynamics 2) Optimal Discrete Modulation Algorithm:...
Ngày tải lên: 03/01/2014, 19:45
Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc
... Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Digital Control of three -Phase Inverter with LC Filter", IEEE Transactions on Power Electronics, Vol 6, No 1, January 1991, pp 62-72 [2] Takao Kawabata, ... Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Dead Beat Control of threePhase PWM Inverter", IEEE Transactions on Power Electronics, Vol 5, No 1, January 1990, pp 21-28 [3] Osman Kükrer, "Deadbeat ... Performance Deadbeat Controlled PWM Inverter using a Current Source Compensator for nonlinear loads", IEEE/PESC 23rd Anual, Toledo, Spain 1992, pp 443-450 [5] Tomoki Yokoyama and Atsuo Kawamura,...
Ngày tải lên: 19/01/2014, 02:20
Báo cáo khoa học: Three-step hydroxylation of vitamin D3 by a genetically engineered CYP105A1 doc
... fragment containing R73V ⁄ R8 4A and FDX1 genes, with HindIII and PstI restriction sites, was prepared using the primers 5¢-ACCAAGCTTATGAAAAGATACCGCCACGACG-3¢ and 5¢-TTCTGCAGTCACCAGGTGACCGGGAGTTCG-3¢, ... Stereochemistry at C(25) Helv Chim Acta 64, 2138–2141 Ishizuka S, Sumitani K, Hiura K, Kawata T, Okawa M, Hakeda Y & Kumegawa M (1990) Biological activity assessment of alpha,25-dihydroxyvitamin D3-26,23-lactone ... Yanai S, Takeda K, Tamura N, Arisawa A & Tamura T (2009) Metabolism of 1a, 25(OH)2D3 by the R73V ⁄ R8 4A variant expressed in E coli cells The metabolism of 1a, 25(OH)2D3 was examined in a reconstituted...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo "Determining thermal expansion coefficients of three-phase fiber composite material reinforced by spherical particles " potx
... final results Firstly, we combine original matrix phase with particle phase in order to creat a new matrix phase, called effective matrix phase In fact, this effective matrix phase is assumed as ... elastic thermal expansion coefficients of matrix and particle phase K , K : bulk moduli of matrix and particle phase G2 = µ2 : shear modulus of matrix phase ξ3 : volume fraction of particle phase ... material of aligned fibres volume fraction of fibre phase transverse linear thermal expansion coefficient of two - phase composite material reinforced fibres * a : axial linear thermal expansion...
Ngày tải lên: 28/03/2014, 13:20
Three phase a c circuits
... Example 3.3 Q A balanced load of phase impedance 100 and power factor 0.8 is connected (a) in star, and (b) in delta, to a 400 V, 3 -phase supply Calculate the power dissipation in each case A ... star-connected stator of a three -phase, 50 Hz alternator supplies a balanced delta-connected load Each phase of the load consists of a coil of resistance 15 and inductance 36 mH, and the phase ... for phase and line currents A star-connected alternator stator generates 300 V in each of its stator windings (a) Sketch the waveform and phasor diagrams for the phase voltages, and (b) calculate...
Ngày tải lên: 03/04/2014, 20:52
IEC 60909 3 short circuit currents in three phase a c systems currents during two separate sim
... International, governmental and nongovernmental organizations liaising with the IEC also participate in this preparation IEC collaborates closely with the International Organization for Standardization ... international use and are accepted by IEC National Committees in that sense While all reasonable efforts are made to ensure that the technical content of IEC Publications is accurate, IEC cannot ... court -circuit dans les réseaux triphasés courant alternatif – Partie 3: Courants durant deux courts-circuits monophasés simultanés séparés la terre et courants de courtcircuit partiels s'écoulant...
Ngày tải lên: 04/04/2014, 11:58
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx
... Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction: a report of the American College of Cardiology/American ... The pharmacoinvasive treatment strategy is supported by recent registry data (82-84) and study data (85) Facilitated PCI In contrast to pharmacoinvasive therapy, the strategy of facilitated PCI ... provided that the patient does not suffer from a true allergy to ASA This initial loading dose may also be given to patients who are already on ASA for reasons of primary or secondary prophylaxis Clopidogrel...
Ngày tải lên: 18/06/2014, 12:20
Báo cáo hóa học: " Magnetic and Cytotoxicity Properties of La12xSrxMnO3 (0 £ x £ 0.5) Nanoparticles Prepared by a Simple " pptx
... of paramagnetic phases of LMO contamination in the samples with x = 0.1 and 0.2 The MS value increases as the Sr content increases and shows the highest value at x = 0.3 and then decreases as ... preparation of manganite nanoparticles, and gives a potential avenue for further practical scale-up of the production process and applications Acknowledgments The authors would like to thank ... nm by the plate reader (Biorad, Japan) The average value of four wells was used for each sample and two repeats were done in each experiment The control NIH 3T3 cell viability was defined as 100%...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo hóa học: " Nanostructured Hypoeutectic Fe-B Alloy Prepared by a Self-propagating High Temperature Synthesis Combining a Rapid Cooling Technique" ppt
... cooling Taking the Fe–B binary phase diagram [24] into account, the c-Fe(B) phase undergoes two solid/solid transformations The formation of polycrystalline phase instead of a single crystal phase ... prepare the bulk nanostructured hypoeutectic Fe94.3B5.7 alloy The Fe94.3B5.7 alloy is characterized by a lamellar eutectic with t-Fe2B and a- Fe phases The eutectic laminar space is about 50 nm and ... micrometers The dendrite phase has tetragonal structure according to the phase identification by the selected area electron diffraction (SAED) analysis The eutectic colonies Nanoscale Res Lett (2009)...
Ngày tải lên: 22/06/2014, 01:20
Báo cáo hóa học: " A Rapid Synthesis of Oriented Palladium Nanoparticles by UV Irradiation" ppt
... doi:10.1351/ pac196920010025 26 S Navaladian, B Viswanathan, R.P Viswanath, T.K Varadarajan, Nanoscale Res Lett 2, 44 (2007) doi:10.1007/s11671006-9028-2 27 H Fujiwara, S Yanagida, P.V Kamat, J Phys ... (2008) 19 M.L Blokhina, A. I Blokhin, M.Ya Nikulin, M.G Derikova, Powder Metal Metab Ceram 35, (1996) 20 S Navaladian, C.M Janet, B Viswanathan, T.K Varadarajan, R.P Viswanath, J Phys Chem C 111, ... 10.1039 /a7 06100e A. A Athawale, S.V Bhagwat, P.P Katre, A. J Chandwadkar, P Karandikar, Mater Lett 57, 3889 (2003) doi:10.1016/S0167577X(03)00235-0 10 C.Y Wang, Y Zhou, Z.Y Chen, Q.Y Lu, X Mo, J Nanopart...
Ngày tải lên: 22/06/2014, 01:20
báo cáo khoa học: " Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin" doc
... estimated 3.1× haploid genome coverage and has been gridded onto 24 high-density filters [42] A 459 bp probe (amplified using primers 5'AAAAAGCAGGCTTTCGACGAAGTGTCCAGG 3'and 5'AGAAAGCTGGGTTGCCCAAGAGACTACCCA ... PLACE database http://www.dna.affrc.go.jp/PLACE/[25] BLASTn analyses were performed using NCBI databases [44], Plant Transcript Assembly database http://blast.jcvi.org/euk-blast/ plantta_blast.cgi, ... Research Council of Canada Collaborative Research Organization grants to IA are gratefully acknowledged FWS thanks Juvenile Diabetes Research Foundation and Canadian Institutes for Health Research...
Ngày tải lên: 12/08/2014, 03:20
vector analysis of a three-phase stator
... the voltages i a R a and La dt to the magnetic axis of winding aa' without changing their magnitudes The vector summation r dia r of i a R a and La along the magnetic axis of winding aa', produces ... circuits, an electrical circuit for electrical analysis and a magnetic circuit for magnetic analysis [11] However, quantities in the electrical circuit affect quantities in the magnetic circuit and ... differential equation for winding b as vb = i b Rb + d λb dt (5) where, vb , i b and λb are the scalar phase supply voltage, scalar phase current and scalar phase flux linkage respectively and Rb...
Ngày tải lên: 26/10/2014, 14:40
High performance control of a three phase PWM rectifier
... by (2.8) and (2.9) is of non-minimum phase as the resultant internal dynamics is unstable as presented in appendix A The non-minimum phase feature appears as right half plane (RHP) zeros in a ... of a PWM rectifier is a challenging task because besides having MIMO non-linear structure, the rectifier also exhibits a non-minimum phase feature Appendix A shows a detailed analytical and qualitative ... in phase loads can be particularly severe if large single phase loads, such as arc furnaces are used [6-7] Asymmetrical winding of transformers which will cause different voltage drops in each...
Ngày tải lên: 11/09/2015, 16:04