5 surgical techniques used to achieve a complete cytoreduction in selected patients

... challenge of accessing an International Baccalaureate (IB) programme in a language other than their mother tongue To enable learners to fully participate in both the academic and social aspects of school ... essentially a way to nudge a student toward higher level performance and may help them reach the goal of being an autonomous learner As every individual interprets a learning experience in a way that ... language and strategies and techniques may be that all of the participants were working in the PYP in an International Baccalaureate authorized school and had completed the initial IB Making the...

Ngày tải lên: 12/08/2016, 19:37

... Plato’s world are precisely those that are objectively true Indeed, I would regard mathematical objectivity as really what mathematical Platonism is all about To say that some mathematical assertion ... contentious, I have taken pains to make it clear to the reader when I am actually taking such liberties Accordingly, this book may indeed be used as a genuine guide to the central ideas (and wonders) ... notably the presentation of certain quantummechanical issues, to Subir Sarkar for valuable information concerning cosmological data and the interpretation thereof, to Vahe Gurzadyan likewise, and...

Ngày tải lên: 17/03/2014, 14:53

... and NA (A) Seasonal amino acid next (A) Seasonal amino acid distances of H3N2 HA and NA proteins since 1999 and (B) amino acid distances of H3N2 HA and NA from one season to the next The same ... 2005-2006 Influenza Season in the United States JAMA 2006, 295:891-894 Barr IG, Hurt AC, Iannello P, Tomasov C, Deed N, Komadina N: Increased adamantane resistance in influenza A( H3) viruses in Australia ... Detection of amantadine-resistant variants among avian influenza viruses isolated in North America and Asia Virology 2005, 341:102-106 Suzuki H, Saito R, Masuda H, Oshitani H, Sato M, Sato I: Emergence...

Ngày tải lên: 20/06/2014, 01:20

... than one way to skin a cat · There are more ways than one to skin a cat · There are more ways of killing a cat than choking it with cream · There are more ways of killing a cat than by choking ... more than one way to skin a cat (Cậu thấy Một to n có nhiều cách giải) - That’s what counts It goes to show you that the same goal can be achieved in more than one way (Đó điểm yếu Qua ta thấy ... There are more ways of killing a dog than hanging him · There are more ways of killing a dog than choking him with pudding Câu thành ngữ xuất phát từ câu nói người Anh: “more ways of killing a cat”...

Ngày tải lên: 29/06/2014, 07:20

... person or a suitable alternate is available to attend the meeting and make a report Notify everyone who needs to know about the meeting Early notification is important to ensure that the required ... more passionate about the topic Keep the discussion focused on the topic Avoid topic drift, when participants add comments that are irrelevant to the agenda The comments are usually interesting, ... before anyone receives a second opportunity Encourage input from all participants Sometimes a few participants dominate the discussion because they are more comfortable speaking in a group or are...

Ngày tải lên: 06/09/2015, 23:57

... forms, including formal and informal mentoring, sales coaching by managers, and/or classroom training, distance- or e-learning, and other kinds of training q MENTORING In mentoring, salespeople ... managers are easy to use, are designed to appeal to and engage salespeople regardless of experience level, and, above all, can be used in manageable pieces so that sales teams can absorb and actually ... self-esteem can sometimes take a beating, but organizations that find ways to build their salespeople’s self-esteem reap an invaluable dividend: according to Jay Abraham, marketing strategist, when salespeople...

Ngày tải lên: 20/12/2013, 19:15

... accommodation regarded as normal for a comparable family in Malta and which meets the general health and safety standards in force in Malta; v are in possession of a valid travel document; and vi are in possession ... THE MAIN THING IS TO START WITH AN INTERESTING ALPHA PROPOSITION ” HFM: How can start-ups attract an investor’s interest? PC: The main thing is to start with an interesting alpha proposition and ... for start-ups is that we are seeing investors widen their investment mandates Managers have to be exactly in the investors’ mandate to have any chance of raising assets When those mandates are...

Ngày tải lên: 07/03/2014, 16:20

... can lead to an information gap that is readily filled by the grapevine This has created a new kind of challenge for managers—that of finding a reliable source of information and keeping an adequate ... mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager to play almost a parental role I, personally, ... success measures Managers wear multiple hats Manager as a conduit Team building – define playing positions Team building – winning as a team Communicate in a timely manner – reduce layers, add clarity...

Ngày tải lên: 23/03/2014, 13:20

... Question Answering, pages 17 —24, Taipei, Taiwan, August 31st — September 1st Marius Pasca and Sanda Harabagiu 2001 High performance question/answering In Proceedings of the 24th Annual International ... Applied Natural Language Processing (ANLP-2000), Seattle, WA Sabine Buchholz and Walter Daelemans 2001 SHAPAQA: shallow parsing for question answering on the World Wide Web In Proceedings of RANLP ... previously enumerated, we had to develop some basic tools which one expects to find in any language All our attempts to locate a tokenizer and a stemmer failed A large number of tools and resources...

Ngày tải lên: 31/03/2014, 20:20

... know at a troubled company recently launched a crucial sales campaign that in the best case may enable the company to raise everyone’s pay and in the worst case may result in huge layoffs and ... Communicate for weeks after a layoff In each case everything that can be communicated, employees interpreted leadership’s both in writing and face -to- face Be absence as a sign that something truly ... riding on a train from able to talk about the team’s fears and than the front entrance to come and go, Washington, DC, to New York Fellow problems along the way so determined were they to avoid...

Ngày tải lên: 27/05/2014, 13:01

... work based curriculum has several stages Analysis based on changing workplaces and situated learning      Learning in workplaces is valued Move from teaching, instruction and supervision to ... profession, industry, and government Higher education has to review its separatist views on learning and respond to the changing workplace International research in a community of practice An invitation ... impact of these changes on the practicum and the educational institutions’ relationship with the sector and can we maintain separatist structures? Is what we profess, what we practice? Paradigm...

Ngày tải lên: 27/05/2014, 13:25

... Influenza Virus Resource [11] and then aligned using Clustal X [12] To gain an initial insight into possible recombination events, each of the eight data sets was analyzed respectively using the ... shifts for each of the recombinants have strong bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs from ... present in a mixed sample to begin with Such artifactual contigs are also likely to be produced in a mixed sample by template switching during PCR amplification [20] even if only a single primer...

Ngày tải lên: 20/06/2014, 01:20

Ngày tải lên: 27/06/2014, 23:20

... we'll address the skirt shape Draw a line straight up the middle about 3/4 of the way, and add a miniature 'T' top to it At the bottom of the line, make a small, narrow upside down 'V' and erase ... apart halfway down the sides of the face and add thick eyebrows at odd angles for personality The nose is a small arc in the center of the face, on top of a banana-shaped mouth Step - Arms and ... line connecting the two legs of a pair of shorts between the points On the body, draw an arc to create the neck and collar line Sleeves will be similar in shape to the body, only smaller and angled...

Ngày tải lên: 28/06/2014, 21:20

... establish a cloud backend to run the application against Many applications need the ability to login a new user and store data in shared collections Get a Kinvey account If you don’t have a Kinvey ... is also trying to display a frame A strategy that lets you avoid JavaScript completely in your callback is to use CSS animations instead Using CSS animation both simplifies your app and lets animations ... alternatively, it can be packaged as a self-contained app that runs in its own web view and that many people might find indistinguishable from a “native” app Unlike an HTML5 app, a native mobile app...

Ngày tải lên: 21/07/2014, 11:52

... Group on Behaviour and Health, Faculty of Nursing, Laval University, Québec, Canada 2Canada Research Chair on Behaviour and Health, Laval University, Québec, Canada 3Faculty of Nursing, Laval University, ... instrument involves qualitative and quantitative approaches The qualitative part consisted of obtaining information relevant to the study behaviour (i.e., adopting the new nursing role) according to ... of leadership skills and the nursing shortage are targets that administrators can work on to raise the proportion of high intenders among school nurses and to advance them towards an expanded...

Ngày tải lên: 10/08/2014, 10:23

... AQGV-GITLS -PVQAKRAND -PVQAQRANA -PVQAQRANA -PVQAQRANS -PVQAKRAND SPVQAQRAQQ -PVQAERANA -PVQAERGNA -PKQAARANA -PVQANRAIA LAAAQSLAHK LAAAQGLDDK LAAAQGLADK LAAAQGLADK LAAAQSLSHK LADAQGLNGK LAAAQGLADK ... sequence (5’ to 3’) Forward CAGTGGACTTAAAACCATAAAGGGAGC CCACATACTCTATATCATTCACACGAG Forward TGATTAACAGGGACAGTCGG Reverse b-tubulin CGCCAATCATAGGAGATATTGCATATG Reverse 18S rRNA GAAGCAAGTTTCCAACAGGTCG ... (5’ to 3’) GCACAATAAATTGGGCCTGA GCGAGTGTTGGGCTAAGTCT Reverse KSC138-23 TAAAGCCGCCTAGCCGATTG Forward TGCAGCAATAATCAATCAAATAGAA Reverse KSC138-22 TTCAATCAAATTTAGCACGTGTATT Forward CGGTCCAGATTTAATTCTTTCACTC...

Ngày tải lên: 11/08/2014, 11:21

... and far from being validated, it can be regarded as a useful method to compare LUS examinations, an evergrowing exam with a strong inter-operator variability Page of Competing interests The authors ... report an increasing quality of the examinations during the study period, as a prompt for operators to consider all the parameters required for a complete LUS reporting In the same way, the standardize ... pneumothorax was generally adequate, whereas incomplete Page of reporting was common for diaphragm motility and lung consolidations Diaphragm motility was often not evaluated with missing information about...

Ngày tải lên: 13/08/2014, 23:20

... sylvatica Other Abies alba Fagus sylvatica 57 45 Fagus sylvatica and other broadleaves Abies alba 456 12 102 93 147 410 Abies alba Fagus sylvatica and other broadleaves Abies alba Fagus sylvatica and ... other broadleaves Acer pseudoplatanus 75 85 Acer pseudoplatanus 60 Fagus sylvatica and other broadleaves Abies alba 10 Acer pseudoplatanus 80 63 Abies alba Living trees (trees/ha) Abies alba Fagus ... 32 Total 200 456 Abies alba 516 Total *See explanations in the text 24 Other Abies alba 492 440 Total Facimiech 12 Abies alba Other 228 Fagus sylvatica Gródek 150 Fagus sylvatica and other broadleaves...

Ngày tải lên: 07/08/2014, 03:22

... were obtained in all 22 GCA patients and in 27 of 33 non-GCA patients, but because all 18 positive biopsies in GCA patients were directed to a particular arterial segment after obtaining the ... CDS examination remained unremarkable Notably, halo signs disappeared in all 18 patients who were diagnosed with GCA within a mean of 22 days after initiation of corticosteroid treatment In nine ... diagnosis in all In three additional cases (2 patients with infectious diseases and patient with Wegener's granulomatosis; Table 2), a unilateral halo sign was found in CDS In the first case, a...

Ngày tải lên: 09/08/2014, 08:22