5  adding and removing members of a group

A study on syntactic, lexical semantic and rhetorical features of word groups containing words denoting seasons in vietnamese and english

A study on syntactic, lexical semantic and rhetorical features of word groups containing words denoting seasons in vietnamese and english

... of descriptive research, observation and - Collecting and classifying data investigation are methods of collecting data Observation and - Analyzing data investigation techniques can be part of ... semantic and pragmatic features of the word “m a in Vietnamese and “season” in English -A study of semantic and stylistic features of WGCWSs (spring, summer, autumn and winter) in English and ... theories and dealt with those of word groups In addition, the three kinds Those are norminal groups, verbal groups and adjectival definitions and classifications of metaphor have been focused on groups...

Ngày tải lên: 26/11/2013, 13:16

13 1,1K 1
Báo cáo y học: " Personality disorders and psychosocial problems in a group of participants to therapeutic processes for people with severe social disabilities" docx

Báo cáo y học: " Personality disorders and psychosocial problems in a group of participants to therapeutic processes for people with severe social disabilities" docx

... contributed to the acquisition of data and to the drafting and revision of the manuscript MOLL participated in the analysis and interpretation of data All authors read and approved the final manuscript ... Miral s/n, 50009 Zaragoza, Spain Correspondence: Departamento de Psicolog a y Sociolog a Universidad de Zaragoza San Juan Bosco, 50009 Zaragoza (Espa a) E-mail: salavera@unizar.es ABSTRACT: Background: ... stay in the center For statistical analysis of the data, the statistical program SPSS 15.0 version was used A descriptive analysis was performed (maxima, minima, averages and standard deviation)...

Ngày tải lên: 11/08/2014, 16:21

20 325 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 5

Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 5

... Hirakawa, H., Ohshima, K., Yamashita, A. , Shiba, T., Ogasawara, N., Hattori, M., Kuhara, S., and Hayashi, H (2002) Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater ... 69-77 Karjalainen, T., Waligora-Dupriet, A J., Cerquetti, M., Spigaglia, P., Maggioni, A. , Mauri, P., and Mastrantonio, P (2001) Molecular and genomic analysis of genes encoding surfaceanchored ... Rubie, E A. , Ahmad, M F., Avruch, J., and Woodgett, J R (1994) The stress-activated protein kinase subfamily of c-Jun kinases Nature 369, 156-160 Lachumanan, R., Armugam, A. , Durairaj, P., Gopalakrishnakone,...

Ngày tải lên: 16/09/2015, 15:54

63 401 0
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated biodiesel fuel A general ... properties and combustion parameters "X" variable % of Unsaturation Density Cetane number Heating value Iodine value "Y" variable Start of dynamic injection bTDC Ignition delay Maximum heat release rate...

Ngày tải lên: 05/09/2013, 15:28

20 483 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

... Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million ... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ... Vitoloi S Brassica Carinata as an alternative oil crop for the production of biodiesel in Italy: engine performance and regulated and unregulated exhaust emissions Environmental Science and Technology...

Ngày tải lên: 05/09/2013, 16:11

12 568 0
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

... southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran oil is extracted ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... Nagarajan.G, Mahua (Madhuca indica) seed oil: A source of renewable energy in India, Journal of Scientific and Industrial Research 64, (November 2005): 890 – 896 R Raghu has completed master of...

Ngày tải lên: 05/09/2013, 16:11

10 552 0
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

... higher than for the MERS case The influence of actual switch characteristics and thermal capability has been investigated An average peak junction temperature of 125°C and 80°C heat sink temperature ... Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called mers with low on-state voltage igbts ... generator voltage and the maximum output power can be increased A configuration using a variable series compensation device called a magnetic energy recovery switch (MERS) and a diode bridge has...

Ngày tải lên: 15/10/2013, 16:11

6 802 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal state variable which is physically meaningful : that ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...

Ngày tải lên: 03/01/2014, 19:44

8 518 1
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... subunit molecular mass was also estimated by SDS–PAGE Characterization and comparative analyses of HYDJs and HYDBp The optimal temperature for activity of HYDJs with d-pHPH as substrate was determined ... HYDJs activity, and intriguingly, mutagenesis of Leu92 to Ala and Val, two smaller hydrophobic residues, actually reduced the catalytic activity to less than approximately 50% of that of the ... of uracil, thymine and several anti-cancer drugs [38] Interestingly, annotation of the DNA sequences flanking the Jannaschia sp CCS1 HYDJs revealed an ORF encoding a putative allantoate amidohydrolase,...

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... assigned and integrated, with concomitant cycles of structure calculations for evaluation of distance and angle constraint violations as well as assignments of additional peaks based on the preliminary ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 Torres AM, Tsampazi...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8 ... Calculations of the interior volume of the dodeca˚ hedral particle based on a cavity radius of 40 A in hAd2 ⁄ 12pb and hAd2pb give a volume of ˚ $ 300 000 A3 , too small to accommodate an extra...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... Luria–Bertani broth and isopropyl thio-b-d-galactoside were purchased from USB (Cleveland, OH) Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl2, NaCl and ... 50 mm NaHPO4 ⁄ 200 mm NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL)1 Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 ... (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, 10 · reaction...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

... significant 5¢-CGGGATCCTAGACCGGCTAACAAGTA-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ ... 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCCCATTTCAAACTTGAG-3¢ 5¢-GCACATTGGGAAACGCTA-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-CCTGTTGTGCACATTGGG-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-ACCTCAAGATGTGCCACT-3¢ 5¢-TCCATCGGTCATGCTCTG-3¢ ... 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCGCTGAACTGAGAGGTTAG-3¢ 5¢-CGGGATCCAGCAGTATGGTGTCCGTG-3¢ 5¢-GGAATTCACCGTCACTTCGCTTGAG-3¢ 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCAGGGTGTCATAGGCCA-3¢...

Ngày tải lên: 20/02/2014, 02:21

8 434 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... TTCTTCAAGGGCTGGCTCCCT CTGATCTAGAGGTACCGGATCC ATCCTCACGAACAAGCAG GATCGCGATGCAGGCCTT GGACGACTACAGCGTCTTCAGTAGA TCCAAACAGTCAGTTTCTTAACCGT Ó FEBS 2003 cDNA cloning of abalone cellulase (Eur J Biochem 270) ... enzyme cDNA cloning Construction of the cDNA library and cloning of cellulase cDNA was achieved as follows: Total RNA was extracted from g of abalone hepatopancreas by the ganidinium thiocyanate-phenol ... cDNA Open and closed boxes indicate translational and untranslational regions, respectively Relative positions of Hd1-DNA, Hd2-DNA, Hd5RACE-DNA, Hd3RACE-DNA, and HdFull-DNA are indicated as solid...

Ngày tải lên: 20/02/2014, 23:20

8 511 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... a CaF2 crystal and allowed to stand at room temperature until all free water was evaporated After this, IR spectra were recorded at room temperature and at 37 °C Usually, the original spectra ... 4¢-phosphate by a galacturonic acid, is biologically, i.e agonistically as well as antagonistically, completely inactive The lack of antagonistic activity may be explained by the fact that this ... of one major band around 1225 cm)1 in accordance with the well-known high water-binding capacity of lecithin headgroups [30] Finally, MfGl-II exhibits a main band at 1245 cm)1 and further weak...

Ngày tải lên: 21/02/2014, 00:20

9 665 1
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

... explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity against Gram-negative ... being least active against S marcescens Mastoparan is far less active in inhibiting growth of Gram-negative bacteria and melittin is only active against three of the Gram-negative bacteria at the ... (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the...

Ngày tải lên: 21/02/2014, 15:20

12 598 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

... 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase gene family ... 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... Km(lM) Relative Vmax (% of coumarate) Relative Vmax/Km (lM)1) Gm4CL1 Cinnamate 4-Coumarate Caffeate Ferulate Sinapate 3,4-Dimethoxycinnamate Cinnamate 4-Coumarate Caffeate Ferulate Sinapate 3,4-Dimethoxycinnamate...

Ngày tải lên: 22/02/2014, 04:20

12 448 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

... the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... coast of Peninsular Malaysia such as Sg Muda, Sg Pinang, Sg Perak, and Sg Klang are short and steep Open water bodies, natural wetlands, and manmade lakes such as dams, and ex-mining pools are...

Ngày tải lên: 06/03/2014, 15:21

88 583 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

... were made with PYMOL [47] able sequences, some bacterial family 19 chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain at least six ... Haemophilus influenzae, and Pseudomonas aeruginosa Although many plant family 19 chitinases are known, crystal structures are available for only two of these [9,15–17] The first structure of a ... 4-MU-(GlcNAc)3, as also earlier demonstrated by Saito et al [21] On the other hand, ChiG showed activity against a- chitin and b-chitin (supplementary Fig S2), chitooligosaccharides (Figs and 3), carboxymethyl-chitin–remazol–brilliant...

Ngày tải lên: 07/03/2014, 11:20

12 400 0
w