4 4 leptospirosis a worldwide disease of many species and bacterial variants
Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps
Ngày tải lên :
12/08/2014, 04:20
... VA(AC4M) and Figure VA(AC2MAC4M)] of VA/ToLCV constructs in wild type (VA) Comparison of replication efficiencies of both wild type (VA) and various mutants [VA(AC2M), VA(AC4M) and VA(AC2MAC4M)] ... 5'ATGAGCTCATGGCAAGTAAAGGAGAAGAAC-3', and Reverse: 5'-CGGGATCCGAGCTCTTAGAGTTCGTCGTGTTTG-3' The amplified fragment was cloned in the forward orientation in VA/pCAMBIA1391Z, as obtained above, at SacI ... VA(AC2MAC4M)] of VA/ToLCV constructs in tomato plants (A) Total DNA was isolated from the tomato leaves agroinfiltrated with VIGS, VA(AC2M), VA(AC4M) and VA(AC2MAC4M) separately and the release of episome...
- 13
- 428
- 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4
Ngày tải lên :
07/11/2012, 14:17
... financial assistance in case of need; (c) Make higher education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance ... performances and materials Article 35 States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic in children for any ... equality to a fair and public hearing by an independent and impartial tribunal, in the determination of his rights and obligations and of any criminal charge against him Article 11 Everyone charged...
- 28
- 611
- 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
Ngày tải lên :
14/02/2014, 19:20
... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1 -4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... buffer and [c-32P]-ATP MBP was used as an artificial substrate to assess the kinase activity and GST alone was used as a negative control The top panel shows the kinase assay visualized by autoradiography ... (Duchefa, Haarlem, The Netherlands) Tissues were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated...
- 11
- 700
- 0
Acquired Cystic Disease of the Kidney and Renal Cell Carcinoma - part 4 pps
Ngày tải lên :
11/08/2014, 01:22
... European Dialysis and Transplantation Association: EDTA 680; Australia/New Zealand: A/ NZ 70) per 045 035 patient-years (0.100%) The SIR of renal cell carcinoma (International Classification of Disease: ... Fig 48 Size of renal cell carcinoma Fig 49 Size of renal cell carcinoma and diagnostic aids 40 Acquired Cystic Disease of the Kidney and Renal Cell Carcinoma Table 12 Comparison of renal cell carcinoma ... renal cell carcinoma and age was evaluated separately in male and female patients, the incidence was higher at younger ages in dialysis patients (Fig 42 ) Renal Cell Carcinomas in Dialysis Patients...
- 12
- 220
- 0
anthracnose. a fungal disease of shade trees
Ngày tải lên :
20/04/2014, 16:13
... margin • On ash, large, irregular, light brown spots appear, most often along leaf margins (Fig 4) • On linden, large brown areas with black margins appear, especially Fig Leaf symptoms of anthracnose ... anthracnose on sugar maple along main leaf (Photo by M A Hansen) veins The areas are small to large and circular to elongate • On birch, small, irregular, circular, brown spots with dark brown margins ... during April and May The spores are blown and splashed to the buds and young leaves and, with favorable moisture conditions, penetrate and infect the swelling buds and unfolding leaves Long rainy...
- 2
- 107
- 2
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2
Ngày tải lên :
07/11/2012, 14:17
... Remarks 14 a, Use of Grammar 14 a1 Modality 14 a2 Use of Active / Passive voices 14 a3 Sentence order 15 a4 Length of sentences 15 a5 Kinds of sentences 16 b Use of vocabulary 17 b1 Archaic words and ... THOSE OF THE INTERNATIONAL DECLARATION 4. 1 Definition of an International Convention 4. 2 20 Purposes and typical legal characteristics of the International Convention on Human Rights 20 4. 2.1 ... Convention and its realization 23 4. 3.2.2 Remarks 26 a, Use of Grammar 26 a1 Modality 26 a2 Use of Active/ Passive voices 27 a3 Sentence order 27 a4 Length of sentences 27 a5 Kinds of sentences...
- 6
- 634
- 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3
Ngày tải lên :
07/11/2012, 14:17
... language learning, and is therefore of great importance to language teachers Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while these remain ... Modality A modal form is a provision of syntax that indicates the predication of an action, attitude, condition, or state other than that of a simple declaration of fact The modality of a grammatical ... shall be prohibited in all their forms (Article of Universal Declaration of Human Rights) b Use of vocabulary b1 Archaic words and phrases Few archaic words and phrases are found in Declarations...
- 41
- 839
- 3
A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell
Ngày tải lên :
05/09/2013, 14:58
... is change for planar shape, where under the land areas a noticeable decrease takes place It can be seen that for a planar shape, a high fraction of the current is generated at the catalyst layer ... might lead to the onset of pore plugging, which has a detrimental effect of the fuel cell performance This model is used to analyse and evaluate the performance of a planar and a tubular-shaped ... Computational domain The full computational domains for the planar and tubular-shaped PEM fuel cell consist of cathode and anode gas flow fields, and the MEA are shown in Figure 2.2 Model equations...
- 26
- 609
- 0
A contrastive analysis of metaphorical lexis and collocation in english and vietnamese economics discourse
Ngày tải lên :
07/09/2013, 12:58
... seen as a failure to activate suitable metaphors at the conceptual level a failure to assimilate the new to the already existing Many of todays standard meaning of words and expressions began as ... that actually generated war in the Gulf rather than avoidance of war and a continuation of sanctions In economics, Ormerod (19 94) has put forward a similar view of the mechanistic metaphors that ... understand and write, due to an apparent relative absence of metaphor and figurative language, and the frequency of cognate technical terms If this were the case, the L2 reader-writer might be able...
- 33
- 1.1K
- 3
Tài liệu A Short View of the Frauds and Abuses Committed by Apothecaries, by Christopher Merrett pptx
Ngày tải lên :
17/02/2014, 07:20
... the said Act Now this Charter so much declaimed against, prayed only a supply of this defect, and also better and more necessary ways and means, without which, such and all other offenders against ... them have been taken, making an Apothecaries Shop in the Patients House, planting the Cupboards and Windows with Glasses and GallyPots, and not a quarter of the whole made use of He prescribes a ... Medicines, too often contrary to, and destructive one of another, it proceeds that in the Small Pox, and Measles, many are afraid to use Physicians, and commit the care of the sick to Nurses, and Old...
- 206
- 405
- 0
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx
Ngày tải lên :
05/03/2014, 12:20
... Bulletin of the Institute of History and Philology, Academia Sinica 4/ 4, 363-397, 1 942 [4] A Rygaloff, Grammaire élémentaire du chinois, Paris, [in Cao Xuan Hao 2007 [5] Tiee, Henry Hung-Yeh, An Approach ... investigation and choice of dialects are presented Part II provides an overview of the tones and intonation of the Vietnamese language This lays the basis for comparing aspects of Vietnamese intonation ... negativism negative, command sarcasm, affirmative (adapted from Do, 2009: 1 94) Kieu and Grice (…) put it that there is interaction between syllabic tones and intonation Yet, according to Alan,...
- 10
- 2K
- 17
Báo cáo khoa học: "Creative Language Retrieval: A Robust Hybrid of Information Retrieval and Linguistic Creativity" pot
Ngày tải lên :
07/03/2014, 22:20
... Expressing Attitude with Idiom Savant Our retrieval goals in IR are often affective in nature: we want to find a way of speaking about a topic that expresses a particular sentiment and carries a certain ... pragmatic neighborhood of X, ?X, appears to be an accurate and concise proxy for the meaning of X What about adjectives? Almuhareb and Poesio’s set of 2 14 words does not contain adjectives, and ... Attribute-Based and Value-Based Clustering: An Evaluation In Proc of EMNLP 20 04 Barcelona Almuhareb, A and Poesio, M (2005) Concept Learning and Categorization from the Web In Proc of the 27th Annual...
- 10
- 384
- 0
On a Fundamental Reorganisation of the Landesbanks and Savings Banks Sector in Germany ppt
Ngày tải lên :
15/03/2014, 10:20
... interconnectedness of savings banks and Landesbanks It is a matter of public record that key segments of the German Landesbanks lack a stable and self-sustaining business model and have neither a sustainable, ... and critical public debate is of particular relevance Taken as a whole, Landesbanks and savings banks currently pose a considerable financial risk to the Federal Republic of Germany and the public ... have already demonstrated Chart 1: Split of Landesbanks 4. 1 Sparkassenregionalinstitute (SRIs) The integration of savings banks and Landesbanks7 within a single metropolitan area gives rise to a...
- 26
- 499
- 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
Ngày tải lên :
16/03/2014, 04:20
... GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) ... GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGA ATTCACCATTATGGATCGTAGAC) and PCR_MdoD_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTT ... bacteria Table Bacterial strains and plasmids used in this study Plasmids pBAD-ABC pBAdCd pBAyCy pBAD–DmsA–GFP pBAD–DmsA–GFP L1 9A pBAD–DmsA–GFP L19D pBAD–DmsA–GFP L19F pBAD–DmsA–GFP S1 5A pBAD–DmsA–GFP...
- 12
- 445
- 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
Ngày tải lên :
16/03/2014, 04:20
... Ala2 34, Phe235, Ala 243 , Ala 246 , Ser 247 , Gly 248 and Leu 249 of the loop domain, as well as Ala318 and Phe319 from the C-terminal domain FEBS Journal 275 (2008) 6136–6 148 ª 2008 The Authors Journal ... 2VU1 CoA 3.8 5.2 3.9 3.2 3.6 4. 4 3.7 4. 1 4. 5 4. 9 5.3 2VU0 CoA 4. 2 4. 7 4. 1 3.8 3.8 4. 6 3.6 3.9 3.8 4. 9 4. 9 1WL4 CoA 4. 3 4. 9 4. 1 3.8 3.8 – – 3.6 3.8 5.2 4. 8 2IBU CoA 3.8 5.1 4. 3 3.9 4. 2 – – 4. 1 4. 0 ... Biophys Acta 17 84, 1 742 –1 749 33 Fersht A (1999) Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding WH Freeman and Co., New York, NY 34 Haapalainen AM, Merilainen...
- 13
- 472
- 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
Ngày tải lên :
17/03/2014, 01:20
... study of translation edit rate with targeted human annotation In Proceeding of AMTA T Takezawa, E Sumita, F Sugaya, H Yamamoto, and S Yamamoto 2002 Toward a broad-coverage bilingual corpus for ... error rate training in statistical machine translation In Proceedings of ACL2003 Sapporo, Japan F J Och and H Ney 2003 A systematic comparison of various statistical alignment models Computational ... S Jayaraman and A Lavie 2005 Multi-engine machine translation guided by explicit word matching In Proceeding of EAMT pp. 143 –152 D Karakos, J Eisner, S Khudanpur, and M Dreyer 2008 Machine Translation...
- 8
- 546
- 1
a brief history of led zeppeln and its musical impact
Ngày tải lên :
21/03/2014, 21:54
... sound dated The music seems similar to music today The lasting impression of their music is obvious, and can be heard in any Rock band of today.Unfortunately, the machine that was Led Zeppelin came ... their official debut, Led Zeppelin were at the top of the bill at the Playhouse Theater in London, and the Pop Proms at the Royal Albert Hall in London On October 17, '69, a year and two days from ... Bonham had turned the wrong way in his sleep, and asphyxiated himself upon his own vomit A statement was released on December 4, 1980, stating that the band could not go on in its present state After...
- 3
- 323
- 0
of mice and men a comprehensive comparision of the novel and
Ngày tải lên :
21/03/2014, 22:48
... good adaptation of a great book It is a wonderful story of friendship,loneliness, and pain This was an excellent film because it was dramatic but it never went too far and became sappy and overdone ... young and handsome to be the character I had envisioned Overall, the casting and photography was excellent Another reason why I liked the film better was because of its dramatic conclusion At the ... is far more predatory and dangerous than in Steinbeck's novel Initially she acts quite sluttish, but she eventually shows to be naive, lonely, and trapped in an abusive marriage She acts as a feminist...
- 3
- 476
- 0