... progression: 13 cases of ulcerative colitis (UC), 34 tubular or tubulovillous adenomas with low (29 cases) to high (5 cases) grade dysplasia (AD), and 53 infiltrating adenocarcinomas classified using ... for STAT3 Nat Rev Cancer 2009, 9:798-809 33 Karin M: The IkappaB kinase - a bridge between inflammation and cancer Cell Res 2008, 18 :3 34 - 34 2 34 Poutahidis T, Haigis KM, Rao VP, Nambiar PR, Taylor ... colitis (N = 13) , AD = adenomas (N = 34 ; 29 low and high grade), AC = adenocarcinomas (N = 53; T1, 10 T2, 33 T3, T4) cancer and provides innovative data on the role of signaling by TLR -4 both in...
Ngày tải lên: 18/06/2014, 16:20
... 2 Fixed Point Theory and Applications considered the Ishikawa iteration process to approximate the common fixed point of mean nonexpansive mappings in uniformly convex Banach space Takahashi ... 2008, Article ID 47 1 532 , pages, 2008 W Takahashi, A convexity in metric space and nonexpansive mappings I,” Kodai Mathematical Seminar Reports, vol 22, pp 142 – 149 , 1970 L B Ciric, J S Ume, and ... T : E → E a pair of asymptotically nonexpansive mappings with b / 0, and F F S ∩ Fixed Point Theory and Applications F T / ∅ Suppose {xn } as in 1 .4 , {un }, {vn } satisfy ∗∗ , and {an }, {bn...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " CONVERGENCE THEOREMS FOR A COMMON FIXED POINT OF A FINITE FAMILY OF NONSELF NONEXPANSIVE MAPPINGS" pdf
... of approximated sequences for nonexpansive mappings in Banach spaces, Proc Amer Math Soc 125 (1997), no 12, 3 641 3 645 W Takahashi, T Tamura, and M Toyoda, Approximation of common fixed points of ... E-mail address: habtuzh@yahoo.com Naseer Shahzad: Department of Mathematics, Faculty of Sciences, King Abdul Aziz University, P.O Box 802 03, Jeddah 21589, Saudi Arabia E-mail address: nshahzad@kau.edu.sa ... spaces, Nonlinear Anal 54 (20 03) , no 8, 141 7– 142 6 S Reich, Approximating fixed points of nonexpansive mappings, Panamer Math J (19 94) , no 2, 23 28 N Shioji and W Takahashi, Strong convergence of...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo toán học: "The number of graphs not containing K3,3 as a minor" pptx
... 182 139 6525 148 269t15 − 138 1627 236 1 145 022t 14 − 7 942 439 7121 737 354t 13 − 3 247 1 146 1 744 767867t12 − 931 8 73 748 086896665t11 − 1881275802907 541 504t10 − 27 135 0292 5 43 7276160t9 −2 8 43 6 530 10 63 34 6 9952t8 − 2190 731 661 037 66 630 4t7 ... 512t6 41 9 43 040 t4 (3t + 1)5 (t + 3) 19683t 13 − 131 220t12 − 1 837 08t11 + 36 0921 744 t10 + 200 542 37 31t9 +38 87177580t8 + 56 030 333 10t7 + 48 21770 240 t6 + 20 139 21280t5 + 229 048 32 0t4 −97157120t3 − 3 1 43 6800t2 ... − 2190 731 661 037 66 630 4t7 − 1 246 5 145 249 509 539 84t6 −5219 947 999 640 944 64t5 − 1586 749 138 031 0 835 2t4 − 34 0 256650 742 98880t3 48 7 632 1721155584t2 − 41 8 948 289921024t − 1 631 2285790208 3t2 − (3t + 1)(t − 1)...
Ngày tải lên: 07/08/2014, 21:20
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... RIPA buffer (50 mM Tris-Cl; pH 7.5, 1% NP -40 , 0.05% SDS, 150 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG BA4 (b-actin) GAAGGTGTGGTGCCAGATTT ... siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1 Either HeLa cells or 293T cells were transfected ... presence of Rev MATR3 has been characterized as a component of the nuclear matrix structure and has also been suggested to play a role in nuclear retention of hyperedited RNA with the assistance of...
Ngày tải lên: 13/08/2014, 01:21
Tài liệu Module 4: DNS as a Solution for Name Resolution docx
... databases increases as well Similarly, as the DNS zone database size increases, the length of time to resolve DNS queries increases Delegated zones divide a DNS zone database into smaller parts, ... as a traditional primary zone from another BIND-based DNS server To a BIND-based DNS server, Active Directory integrated zones appear as traditional primary zones You can replicate to other Active ... local and remote locations can enhance the availability of DNS By adding additional DNS servers at remote locations, DNS availability can be ensured in the event of a wide area network (WAN)...
Ngày tải lên: 17/01/2014, 08:20
Báo cáo toán học: " Fixed point of generalized weakly contractive mappings in ordered partial metric spaces" docx
... x) + a5 p(f x, y), a1 , a2 > 0, ≥ for i = 3, 4, 5, and, if a4 ≥ a5 , then a1 + a2 + a3 + a4 + a5 < 1, and if a4 < a5 , then a1 + a2 + a3 + a4 + 2a5 < and ψ, φ : R+ → R+ , ψ is a continuous and ... = a1 p(x, y) + a2 p(f x, x) + a3 p(f y, y) + a4 p(f x, y) + a5 p(f y, x), a1 , a2 > 0, ≥ for i = 3, 4, 5, and, if a4 ≥ a5 , then a1 + a2 + a3 + a4 + a5 < 1, and if a4 < a5 , then a1 + a2 + a3 ... (u, u) = a1 p(u, u) + a2 p(f u, u) + a3 p(f u, u) + a4 p(f u, u) + a5 p(f u, u) = (a1 + a2 + a3 + a4 + a5 )p(u, u), that is ψ(p(u, u)) ≤ ψ( (a1 +a2 +a3 +a4 +a5 )p(u, u))−φ( (a1 +a2 +a3 +a4 +a5 )p(u,...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: "APPROXIMATION COMMON FIXED POINT OF ASYMPTOTICALLY QUASI-NONEXPANSIVE-TYPE MAPPINGS BY THE FINITE STEPS ITERATIVE SEQUENCES" pdf
... for quasi-nonexpansive mappings, Journal of Mathematical Analysis and Applications 43 (19 73) , 45 9 49 7 [10] N Shahzad and A Udomene, Approximating common fixed points of two asymptotically quasinonexpansive ... in Banach spaces, Journal of Mathematical Analysis and Applications 267 (2002), no 2, 44 4 45 3 [ 13] Y Y Zhou and S.-S Chang, Convergence of implicit iteration process for a finite family of asymptotically ... quasi-nonexpensive mappings, asymptotically nonexpensive mappings, asymptotically quasi-nonexpensive mappings, and asymptotically nonexpensive type-mappings are all special cases of asymptotically...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo y học: "Proteinase-3 as the major autoantigen of c-ANCA is strongly expressed in lung tissue of patients with Wegener’s granulomatosis" pptx
... phosphatase (APAAP) method (see later) Immunohistochemical double-labeling (APAAP method) Double-labeling was performed using the APAAP method, with monoclonal antibody against CD68 (macrophages ... PR -3 mRNA signal at the sites of granulomas, inflammatory infiltration and vasculitis (Supplementary Fig 3) To obtain a semiquantitative estimation of PR -3 expression difference, we counted all ... PR -3 (magnification, 60 × 2.5) Discussion The diagnosis and classification of WG and related vasculitides were advanced considerably by characterization of serum antibodies that react with PR-3...
Ngày tải lên: 09/08/2014, 03:24
Báo cáo toán học: " Fixed point theorems for contraction mappings in modular metric spaces" pptx
... 227– 238 (1998) [4] Razani, A, Nabizadeh, E, Beyg Mohamadi, M, Homaeipour, S: Fixed point of nonlinear and asymptotic contractions in the modular space Abstr Appl Anal 2007, Article ID 40 575, 10 (2007) ... many branches of mathematical analysis Banach contraction principle has been extended in many different directions, see [2–10] The notion of modular spaces, as a generalize of metric spaces, was introduced ... modular spaces Arch Math 40 , 34 5 35 3 (20 04) [26] Mongkolkeha, C, Kumam, P: Fixed point and common fixed point theorems for generalized weak contraction mappings of integral type in modular spaces Int...
Ngày tải lên: 20/06/2014, 21:20
báo cáo hóa học: " Fixed point results for contractions involving generalized altering distances in ordered metric spaces" pptx
... Dhage BC, O’Regan D, Agrawal RP: Common fixed point theorems for a pair of countably condensing mappings in ordered Banach spaces J Appl Math Stoch Anal 20 03, 16: 2 43 - 248 Harjani J, Sadarangani ... Sadarangani K: Fixed point theorems for weakly contractive mappings in partially ordered sets Nonlinear Anal 2009, 71: 34 0 3- 34 1 0 Harjani J, Sadarangani K: Generalized contractions in partially ordered ... Article ID 62 149 2 Amini-Harandi A, Emami H: A fixed point theorem for contraction type maps in partially ordered metric spaces and application to ordinary differential equations Nonlinear Anal...
Ngày tải lên: 21/06/2014, 02:20
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... able to obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4. 3) Proof of Eilenberg’s ... Polish Acad Sci Math 51 (20 03) , no 2, 147 –156 C Petalas and T Vidalis, A fixed point theorem in non-Archimedean vector spaces, Proc Amer Math Soc 118 (19 93) , no 3, 819–821 S Prieß-Crampe, Der Banachsche...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo y học: " siRNA screen of the human signaling proteome identifies the PtdIns(3,4,5)P3-mTOR signaling pathway as a primary regulator of transferrin uptak" docx
... signaling pathway (b) Quantification of the effects of different siRNAs targeting the PtdIns (3 ,4, 5)P3-mTOR pathway and rapamycin (RAPA) on transferrin uptake Means ± standard error of the mean ... Figure Automated image-based quantification of iron-loaded transferrin uptake in HeLa cells Automated image-based quantification of iron-loaded transferrin uptake in HeLa cells (a) Schematic representation ... (PDK1, alias PDPK1, AKT1, and mTOR, alias FRAP1) are known activators whose knock-down reduces transferrin uptake (Figure 2f) We call such a match of the players, as well as of the direction of the...
Ngày tải lên: 14/08/2014, 07:22
A STUDY OF DYE SENSITIZED SOLAR CELLS WITH IN SITU POLYMERIZED POLY (3,4 ETHYLENEDIOXYTHIOPHENE) AS HOLE TRANSPORTING MATERIAL
... glass was treated by O2 plasma for 18 Compact TiO2 layer was prepared by aerosol spray pyrolysis on cleaned FTO conducting glass. [49 ] To protect the collection area, a piece of glass side was ... current-voltage data were recorded by an electrochemical workstation (PGSTA30, Autolab) Energy conversion efficiency was measured using a mask with an aperture area of 0.15 cm2 2 .3 .4 Measurement of incident ... the area before preparation of compact layer The cleaned FTO glass with glass slide was heated to 45 0 oC for 15 The freshly prepared 0.2 M precursor solution was spayed at a distance of about...
Ngày tải lên: 26/09/2015, 10:05
Báo cáo sinh học: "Fixed point-type results for a class of extended cyclic self-mappings under three general weak contractive conditions of rational type" potx
... Instituto de Investigacion y Desarrollo de Procesos, Universidad del Pais Vasco, Campus of Leioa (Bizkaia) – Aptdo 644 -Bilbao, 48 080-Bilbao, Spain Department of Mathematics, Texas A& M University - ... 7 836 3-8202, USA *Corresponding author: manuel.delasen@ehu.es Email address: RPA: Agarwal@tamuk.edu Abstract This article discusses three weak φ-contractive conditions of rational type for a class ... Nonlinear Anal Theory Methods Appl 71(7–8), 34 0 3 34 1 0 (2009) [3] Bhardwaj, R, Rajput, SS, Yadava, RN: Application of fixed point theory in metric spaces Thai J Math 5(2), 2 53 259 (2007) [4] Enjouji,...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: "Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach" pdf
... Isac, G, Rassias, ThM: Stability of Functional Equations in Several Variables Birkh¨user, a Basel (1998) [ 23] Jung, S: Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis ... Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach Hassan Azadi Kenary1 , Choonkil Park∗2 , Hamid Rezaei1 and Sun Young Jang3 Department ... mappings Glas Mat Ser III 36 (56), 63 72 (2001) [32 ] Rassias, ThM: The problem of S.M Ulam for approximately multiplicative mappings J Math Anal Appl 246 , 35 2 37 8 (2000) ¨ [33 ] Vajzovi´, F: Uber das Funktional...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach" pot
... Isac, G, Rassias, ThM: Stability of Functional Equations in Several Variables Birkh¨user, a Basel (1998) [ 23] Jung, S: Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis ... Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach Hassan Azadi Kenary1 , Choonkil Park∗2 , Hamid Rezaei1 and Sun Young Jang3 Department ... mappings Glas Mat Ser III 36 (56), 63 72 (2001) [32 ] Rassias, ThM: The problem of S.M Ulam for approximately multiplicative mappings J Math Anal Appl 246 , 35 2 37 8 (2000) ¨ [33 ] Vajzovi´, F: Uber das Funktional...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 1 84, 43 1 43 6 (19 94) doi:10.1006/jmaa.19 94. 1211 Jung, S-M: Hyers-Ulam-Rassias Stability of ... S0002-9 939 -1978-050 732 7-1 12 Park, W-G, Bae, J-H: A functional equation originating from quadratic forms J Math Anal Appl 32 6, 1 142 –1 148 (2007) doi:10.1016/j.jmaa.2006. 03. 0 23 13 Margolis, B, Dias, JB: A fixed point ... doi:10.1186/1029- 242 X-2011-82 Cite this article as: Bae and Park: A fixed- point approach to the stability of a functional equation on quadratic forms Journal of Inequalities and Applications 2011 2011:82 Page of ...
Ngày tải lên: 20/06/2014, 22:20