4 strategies for reducing injury table 4 2

... 18 .2 ± 20 .9 44.4 ± 36.3

Ngày tải lên: 18/06/2014, 19:20

... 18 .2 ± 20 .9 44.4 ± 36.3

Ngày tải lên: 20/06/2014, 03:20

... Oxygenation index 12 ± 9 2 0 .21 Quasistatic respiratory compliance (ml/H2O) 27 ± 12 29 ± 10 0. 32 Mean airway pressure (cm H2O) 12 ± 12 ± 0.53 480 ± 120 409 ± 80 0.01 8 .2 ± 2. 2 7 .2 ± 1.8 0. 02 Physiologic ... valueb 1 32 ± 71 186 ± 63 0.003 Plateau pressure (cm H2O) 26 ± 22 ± 0. 02 Peak inspiratory pressure (cm H2O) Clinical characteristic 32 ± 27 ± 0. 02 Positive endexpiratory pressure 6 .2 ± 7 .2 ± 0.16 ... 1,836) 21 9 (10 to 2, 115) 68 (10 to 1,5 52) 0.0003b ICAM-1 (ng/ml) 21 1 (115 to 306) 631 (22 0 to 2, 800) 520 (198 to 3,970) 4 92 (22 1 to 1,780) 0.15 vWF % control 368 (116 to 7 42) 3 12 (40 to 814) 359...

Ngày tải lên: 13/08/2014, 03:20

... including prior brain injury (14 /25 ), seizures (3 /25 ), learning disability (3 /25 ), birth complications (2/ 25), attention deficit hyperactivity disorder (1 /25 ), and congenital syphilis (1 /25 ) This supports ... Neurosciences 6:15 22 , 1994 28 1 Mild Brain Injury and the Postconcussion Syndrome is clearly better than that for moderate and severe injury (Frencham et al., in press; Levin et al 1990; Rees 20 03; Rimel ... patients (Levin et al 20 01) Feinstein et al (20 02) investigated the frequency of intrusive symptoms in a group of 28 2 mixed-severity-TBI outpatients who averaged 53 days postinjury when evaluated...

Ngày tải lên: 10/08/2014, 18:20

... traumatic brain injury Child Nerv Syst 20 06 ;22 : 126 8- 127 4 47 Dickerman RD, Morgan JT, Mitller MA Decompressive craniectomy for traumatic brain injury: when is it too late? Child Nerv Syst 20 05 ;21 :1014-1015 ... severe traumatic brain injury Injury 20 06;37:1 125 -11 32 Coplin WM Intracranial pressure and surgical decompression for traumatic brain injury: biological rationale and protocol for a randomized clinical ... blood measure) Neurol Res 20 02; 24:157-160 22 Mitchell P, Tseng M, Mendelow AD Decompressive craniectomy with lattice duraplasty Acta Neurochir (Wien) 20 04;146:159-160 23 Walker AE, Erculei F Post-traumatic...

Ngày tải lên: 25/10/2012, 11:40

... 34:1 02- 254 Hilgard, E R (1977) Divided Consciousness New York: Wiley Kihlstrom, J F (1987) The cognitive unconscious Science 23 7:1445-14 52 Lebrun, Y (1987) Anosognosia in aphasics Cortex 23 :25 1 -26 3 ... BETSY A TOBIAS 12 Role of Psychological Factors in Disordered Awareness LISA LEWIS 22 3 x CONTENTS 13 Anosognosia and Denial of Illness 24 0 EDWIN A WEINSTEIN 14 Forms of Unawareness 25 8 DANIEL L ... neuropsychological syndromes In L Weiskrantz (ed.), Thought Without Language Oxford: Oxford University Press, pp 24 2 -27 8 Schilder, P (19 32) Localization of the body image (postural model of the body) Assoc...

Ngày tải lên: 11/06/2014, 09:45

... to Table Clinical data ¯ Before treatment (X0 ±σ ) ¯ After treatment (X20 ±σ 20 ) Control Trial 45.38 ± 7.35 41 .22 ± 10.57 46.88 ± 6.15 45.44 ± 8. 62 1.50 ± 1.31 4 .22 ± 2. 33 T**(p = 0.000) GxT*(p ... 14. 82 ± 9. 42 12. 13 ± 4.94 -2. 69 ± 6.19 Trial 15.38 ± 9.69 13. 52 ± 9.60 T*(p = 0.046) -1.86 ± 4.67 NS 1MWT (m) Control 31.13 ± 13.59 36.38 ± 15.39 5 .25 ± 3.99 Trial 31.94 ± 12. 47 42. 69 ± 20 .43 ... 36:1480-1484 Burdea GC: Virtual rehabilitation-benefits and challenges Methods Inf Med 20 03, 42( 5):519- 523 17 18 19 20 21 22 23 24 Page of Teasell R, Meyer MJ, McClure A, Pan C, Murie-Fernandez M, Foley...

Ngày tải lên: 19/06/2014, 08:20

... (1.0) 8.8 (2. 6) -0.435 0.663 Naming 6.4 (1.5) 6.6 (1.7) -0 .21 7 0. 828 Constructional Ability 5.6 (0.9) 4.4 (1.5) -1. 423 0.155 Memory 10 .2 (0.8) 8.8 (2. 8) -0 .21 2 0.8 32 Calculation 3 .2 (1.3) 3 .2 (1.3) ... 1.3 5 .2 ± 1.3 -0.516 0.606 Cognistat Repetition 8.8 ± 2. 2 7.6 ± 3 .2 -0.5 32 0.595 Naming 6.0 ± 1.4 7.6 ± 4.4 -0. 324 0.746 Constructional ability 3.8 ± 1.6 4 .2 ± 1.5 -0. 328 0.743 Memory 8.4 ± 2. 3 ... Memory 8.4 ± 2. 3 8.0 ± 3 .2 -0 .21 2 0.8 32 Calculation 3.0 ± 1 .2 3 .2 ± 0.8 -0.111 0.911 Reasoning 5.8 ± 2. 5 6.6 ± 0.9 -1.063 0 .28 8 Judgment 4.0 ± 0.7 4.6 ± 0.9 -0.437 0.6 62 Cash withdrawals Average...

Ngày tải lên: 19/06/2014, 08:20

... 20 07, 4:13 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Sauerland S, Maegele M: A CRASH landing in severe head injury Lancet 20 04, 364(94 42) : 129 1- 129 2 Barnum SR: Inhibition ... placebo TBI mAb 1379 32 31 30 29 28 27 26 25 24 Baseline pre-TBI 1h 1h 4h 4h 24 h 24 h 7d 7d Time after trauma Figure of matic brain injury (TBI) Kinetics body weight changes for up to days after ... Bcl -2 14433 120 43 136 bp 118 bp commercially available Genexpression Assay QuantiTect Mm_GAPD commercially available Genexpression Assay QuantiTect Mm_Bcl -2 2410 12 241118 Fas C1-Inh 141 02 122 58...

Ngày tải lên: 19/06/2014, 22:20

... Levesque et al Journal of Neuroinflammation 20 11, 8:105 http://www.jneuroinflammation.com/content/8/1/105 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 prepared to support a multipollutant ... 20 00, 96:195 -20 3 Lucas SM, Rothwell NJ, Gibson RM: The role of inflammation in CNS injury and disease Br J Pharmacol 20 06, 147(Suppl 1):S2 32- 240 Levesque et al Journal of Neuroinflammation 20 11, ... and occupational exposure to PM occurs around 1000 - 20 00 μg PM/m3 [22 ,23 ], where human exposure continues for years Diesel exhaust (DE) is a form of air pollution that has received significant...

Ngày tải lên: 19/06/2014, 22:20

... in the pathogenesis of brain edema Acta Neuropathol 20 09, 118:197 -21 7 Page 15 of 16 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Tait MJ, Saadoun S, Bell BA, Papadopoulos MC: Water ... AQP4 Isoform 1: NM_0 128 25.3 Sens: TTGGACCAATCATAGGCGC 770 to 788 Isoform 21 3 pb 98 .2% 90 pb 1 02. 0% 778 to 796 Isoform Isoform 2: NM_0011 423 66.1 Revs: GGTCAATGTCGATCACATGC 963 to 9 82 Isoform NM_017009 .2 ... Clin Chem 20 09, 55:611- 622 Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2( -Delta Delta C(T)) Method Methods 20 01, 25 :4 02- 408 Amiry-Moghaddam...

Ngày tải lên: 19/06/2014, 22:20

... 96.84 ± 2. 618 109.8 ± 3 .28 5** 1 02. 5 ± 2. 703 101.0 ± 1 .27 8 TLR-4 (OD) (protein) 99 .26 ± 4.455 116.9 ± 3.093** 88.09 ± 4.1 42 97.01 ± 3.1 62# # MD -2 (mRNA) 98.01 ± 2. 575 108.4 ± 2. 178** 91.74 ± 2. 4 32 96.86 ... 101.8 ± 2. 546 94 .21 ± 2. 193* 90 .28 ± 2. 0 52 88.16 ± 2. 879 NF-B p65 (OD) (protein) 100.6 ± 3.363 87 .23 ± 3.554* 103 .2 ± 4.530 99.43 ± 3.4 42# IBa (mRNA) 100.0 ± 4 .28 6 118.7 ± 6.436* 95.55 ± 3 .26 5 ... levels 120 MD -2 C 100 80 60 40 20 CMS CONTROL CMS CONTROL CMS CMS TLR-4 - 95kDa MD -2 - 20 kDa actin - 42kDa actin - 42kDa B TLR-4 ** 100 75 50 25 MD -2 100 80 60 40 20 CONTROL CMS * 120 MD -2/ actin...

Ngày tải lên: 19/06/2014, 22:20

... Programme (FP7 /20 08 -20 13) under Grant Agreements 20 1 024 and 20 221 3 (European Stroke Network) (AD) References Brough D, Tyrrell PJ, Allan SM: Regulation of interleukin-1 in acute brain injury Trends ... from C57BL6/H mice (Figure 2C) and CX3CR1-GFP+/- mice (not shown) 24 h after MCAo for IL-1α and IgG (BA -20 00, Vector Labs, biotinylated horse anti-mouse IgG, µg/mL; S- 323 56, Invitrogen, Alexa 594 ... JNeurolNeurosurgPsychiatry 20 05, 76:1366-13 72 Boutin H, LeFeuvre RA, Horai R, Asano M, Iwakura Y, Rothwell NJ: Role of IL-1alpha and IL-1beta in ischemic brain damage JNeurosci 20 01, 21 :5 528 -5534 Mulcahy...

Ngày tải lên: 19/06/2014, 22:20

... ISCHEMIC STROKE (n =29 ) 1.16 (1.71) 2. 56 (3.73) 2. 51 (2. 76) HEMORRHAGIC STROKE (n= 12) P VALUES 4.3 (7.36) 7.16 (9.8) 5.78 (8.15) 0.17 0.14 0 .24 120 .8 (194.47) 1 62. 19 (21 3.16) 128 . 92 (198 .25 ) 61.61 (81.3) ... 0 .28 -1. 82 Mean: 1. 92 (2. 67) mg/dL Median: 0.47 IQ range: 0 .27 -2. 78 P values 0.001 Mean: 76.88 (86.7) pmol/L Median: 36.6 IQ range: 20 .95-99. 32 Mean: 191.45 (20 1.18) Median: 141.55 IQ range: 60.55 -27 4.15 ... CRP-Discharge MEAN 2. 08 3.94 3.44 SD 4.36 6.4 RANGE 0.03 -20 .7 mg/dl 0.09 -26 .13 0.04 -24 .8 NT-PBNP-baseline NT-PBNP-48 hours NT-PBNP-Discharge 103.1 144 .22 111.8 169.7 187.3 171.55 2. 8-6 72 pmol/l 1.6-798.3...

Ngày tải lên: 08/08/2014, 16:23

... exp[−Nt(m6 /M )(∆X )2 ], for a system of N constituents of mass m, assuming that its center of mass gets finally pinned down within ∆X, and is given by τc = M3 Nm6 (∆X )2 (28 ) where M stands for MSU ≈ (1/10)MP ... mnucl ≈ GeV in (28 ) Thus, using M ∼ 1018 GeV, m ∼ GeV, and (∆x) ∼ 1nm ≡ 10−7 cm, (28 ) yields 1016 sec (29 ) N a rather suggestive formula In the case of a single (N = 1) hydrogen atom, (29 ) becomes ... suggestive for a possible use of MTs as “information processors” It should be rather obvious that such a delicate, fine MT organization is there for some good reason  32 Further evidence for the...

Ngày tải lên: 10/08/2014, 00:21

... Atlanta, GA 30 322 , USA and 3Department of Psychology, Virginia Commonwealth University, Richmond, VA 23 284, USA Received: 10 February 20 10 Accepted: 18 May 20 10 Published: 18 May 20 10 © 20 10 Gibson ... 1995, 684 :23 3 -23 6 21 Kao C-Q, Goforth PB, Ellis EF, Satin LS: Potentiation of GABAA currents after mechanical injury of cortical neurons J Neurotrauma 20 04, 21 :25 9 -27 0 22 Swope SL, Moss SI, Raymond ... typically form a limited number of receptor combinations [23 ] Reportedly, the following subunits combine to form nearly 80% of the GABAAR combinations in the rat brain: α1-3, 2- 3, and 2 [23 -25 ],...

Ngày tải lên: 10/08/2014, 05:21

... 1993, 1 92: 129 7-13 02 25 Urabe T, Hattori N, Nagamatsu S, Sawa H, Mizuno Y: Expression of glucose transporters in rat brain following transient focal ischemic injury J Neurochem 1996, 67 :26 5 -27 1 26 ... labelled for PiT1 and PiT2 and irregularly labelled for GLUT1 The Purkinje cells were irregularly labelled for GLUT1 (Figure 1F), PiT1 and PiT2 (Figure 2D) Regional GLUT1, PiT1 and PiT2 distribution ... virus Cell Growth Differ 1990, 1:119- 127 23 Jackson-Lewis V, Przedborski S: Protocol for the MPTP mouse model of Parkinson’s disease Nat Protoc 20 07, 2: 141-151 24 Brant AM, Jess TJ, Milligan G, Brown...

Ngày tải lên: 10/08/2014, 05:21

... incidence= 120 /100,000 United States population size, 20 00 =28 0 million Total new cases in 20 00=( 120 × 2, 800)=336,000 Prehospital brain injury deaths=(0.0001 × 28 0,000,000) =28 ,000 Total cases admitted to hospital ... (multifocal) (Graham et al 20 02) (Table 2 3) TABLE 2 2 brain injury Mechanisms of brain damage after Contact Acceleration/deceleration Injury to scalp Tearing of bridging veins with formation of subdural ... brain injury (the incidence 21 Epidemiology FIGURE 1–16 Adjusted odds ratios for predictor variables for outcome: death after brain injury MAIS=Maximum Abbreviated Injury Scale (Association for...

Ngày tải lên: 10/08/2014, 18:20

... Hypothalamus * 2, 4,10,36,47, 52 Limbic system –– Amygdala ** 11 ,29 Hippocampus ** 5,14–16 Fornix * 22 ,24 ,25 Mammillary body * 22 ,25 Anterior thalamus * –– Cingulate gyrus * 53 * 22 ,25 Midbrain Cerebral ... *** 11,16 ,21 ,23 ,25 ,33,39,49,50 Ventricular system Lateral ventricle 19 ,27 ,41,51 ** 11, 12, 13,17,18 ,20 ,37,48 Anterior (frontal) *** 12, 13,17 Body *** 12, 13,17 Posterior (occipital) *** 12, 13,17 Inferior ... acquired brain injury (Derdeyn 20 01; Govindaraju et al 20 04; Levine et al 20 02; Makris et al 1997; McGowan et al 20 00; Scheid et al 20 03; Sinson et al 20 01; Toga and Thompson 20 01) The exciting...

Ngày tải lên: 10/08/2014, 18:20