... Kim JC, Kim SY, Cho DH, Ha YJ, Choi EY, Kim CW, Roh SA, Kim TW, Ju H, Kim YS: Novel chemosensitive single- nucleotide polymorphism markers to targeted regimens in metastatic colorectal cancer Clin ... TLR4) For rs4986790 (TLR4 8552A > G), PCR was performed with the forward primer 5’-CTG CTC TAG AGG GCC TGT G-3’ and the reverse primer 5’-TTC AAT AGT CAC ACT CAC CAG-3’, resulting in a 140 bp fragment ... for rs4986791 (TLR4 8852C > T), PCR was performed with the forward primer 5’-CTA CCA AGC CTT GAG TTT CTA G-3’ and the reverse primer 5’-AAG CTC AGA TCT AAA TAC CT-3’ After denaturation at 95°C,...
Ngày tải lên: 18/06/2014, 22:20
... Kim JC, Kim SY, Cho DH, Ha YJ, Choi EY, Kim CW, Roh SA, Kim TW, Ju H, Kim YS: Novel chemosensitive single- nucleotide polymorphism markers to targeted regimens in metastatic colorectal cancer Clin ... TLR4) For rs4986790 (TLR4 8552A > G), PCR was performed with the forward primer 5’-CTG CTC TAG AGG GCC TGT G-3’ and the reverse primer 5’-TTC AAT AGT CAC ACT CAC CAG-3’, resulting in a 140 bp fragment ... for rs4986791 (TLR4 8852C > T), PCR was performed with the forward primer 5’-CTA CCA AGC CTT GAG TTT CTA G-3’ and the reverse primer 5’-AAG CTC AGA TCT AAA TAC CT-3’ After denaturation at 95°C,...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: "Association of IL-4RA single nucleotide polymorphisms, HLA-DR and HLA-DQ in children with Alternaria-sensitive moderate-severe asthm" pptx
... Alternaria -sensitive moderate-severe asthma is compared to Alternaria -sensitive mild asthma in children Comparison of Alternaria -sensitive moderate-severe asthmatics to Alternaria -sensitive mild ... forward and reverse sequencing primers were used to maintain quality control Primer sequences and conditions are available upon request The presence of IL-4RA nucleotide polymorphisms was examined ... increased in Alternariasensitive moderate severe asthmatics compared to Alternaria -sensitive mild asthmatics Immunotherapy was part of the treatment in 4% of Alternaria -sensitive moderate-severe...
Ngày tải lên: 13/08/2014, 13:22
Báo cáo y học: "Translational Medicine and Reliability of Single-Nucleotide Polymorphism Studies: Can We Believe in SNP Reports or Not"
... increasing rapidly and this trend is expected to accelerate due to the availability of mapped single- nucleotide polymorphisms (SNP) in the human genome and advances in genotyping technologies [1] ... Asp147Tyr (n=1) [15], GSTM3 (n=2) [26,63], GSTA1 (n=1) [91], GSTO1 (n=1) [38], GSTO2 (n=1) [44] Single studies characteristics for each of the 79 eligible studies are reported in the appendix ... their study regardless of the outcome It should be emphasized, however, that the transition from single SNP studies to genome-wide association studies (GWAS)––of cohorts sufficiently large in size...
Ngày tải lên: 25/10/2012, 10:51
Tài liệu Báo cáo khoa học: Fra-1 targets the AP-1 site/2G single nucleotide polymorphism (ETS site) in the MMP-1 promoter docx
... probe was created by PCR, using primers to amplify a region unique to the transcript The forward primer for Fra-1 was 5¢-TCTGGGCTGCAGCGAGAGATTGAGGAG-3¢ and the reverse primer was 5¢-GGAGGAGACATTGGC ... (Gibco/ BRL) in · polynucleotide kinase buffer (Roche) and · 106 c.p.m were incubated with lg of nuclear extract for 20 at °C This amount was needed for probe excess with the 2G oligonucleotide Lesser ... M.P & Brinckerhoff, C.E (2002) Erk 1/2 differentially regulates the expression from the 1G/2G single nucleotide polymorphism in the MMP-1 promoter in melanoma cells Biochim Biophys Acta 1586, 265–274...
Ngày tải lên: 21/02/2014, 00:20
BÁO CÁO " MỐI TƯƠNG QUAN GIỮA SNP (Single nucleotide polymorphisms) CỦA GEN CHH (crustacean hyperglycemic hormone) VÀ TÍNH TRẠNG TĂNG TRƯỞNG CỦA TÔM CÀNG XANH " potx
... Thiết kế primer, ly trích DNA, phản ứng PCR giải trình tự Primer thiết kế từ trình tự CHH M rosenbergii (Chen ctv, 2004, GenBank accession no AF372657) công bố, sử dụng chương trình Primer (v.0.4.0) ... trình Primer (v.0.4.0) (http://frodo.wi.mit.edu/) Primer thiết kế khuếch đại đoạn mã hóa (exon) không mã hóa (intron) gen CHH Thông tin chi tiết primer trình bày Bảng Chi tiết đoạn gen CHH trình ... Technologies), pha loãng để đạt nồng độ 100 ng/µl cho phản ứng PCR 50 Bảng Chi tiết primer khuếch đại gen CHH M rosenbergii Đoạn gen Primer Ký hiệu Độ dài Tên Trình tự (5’-3’) (bp) CH1 401 CH1F CCCCCACAACTTTGTCAGTT...
Ngày tải lên: 19/03/2014, 11:20
single nucleotide polymorphisms - pui-yan kwok
... reverse primer To obtain NED-labeled amplicon, a NEDlabeled forward primer is used together with an unlabeled reverse primer For the ROX- labeled species, the reverse primer is labeled and forward primer ... products are denatured to become single- stranded, and separated by gel electrophoresis under nondenaturing conditions A single- stranded fragment with a mutation or single nucleotide polymorphism (SNP) ... Kenneth J Livak 129 vii viii Contents 10 Genotyping SNPs by Minisequencing Primer Extension Using Oligonucleotide Microarrays Katarina Lindroos, Ulrika Liljedahl, and Ann-Christine Syvänen...
Ngày tải lên: 08/04/2014, 12:52
Báo cáo khoa học: "Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)" potx
Ngày tải lên: 07/08/2014, 23:22
Báo cáo y học: "NGR1 single nucleotide polymorphisms in rheumatoid arthritis" pdf
... direct sequencing PCR primer and probe sequences for the V14M SNP were 5' -AGTGGAGTGGCTACAAAGGTCCC-3' (forward primer) and 5' CCCATCTCAGCCCTGCTCAC/T-3' (reverse primer) PCR primer and probe sequences ... sequences for the L467P SNP were 5' CATGTGCTAGTGGATCTACT/C-3' (forward primer) and 5' AGTGGAGTGGCTACAAAGGTCCC-3' (reverse primer) Results and discussion In marked contrast to previous findings, ... Kaneko H, Inoue R, Fukao T, Watanabe M, Teramoto T, Kato Z, Suzuki K, Suzuki Y, et al.: A novel single- nucleotide substitution, Leu 467 Pro, in the interferon-gamma receptor gene associated with...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Association of PTPN22 1858 single-nucleotide polymorphism with rheumatoid arthritis in a German cohort: higher frequency of the risk allele in male compared to female patients" potx
... fragment of the PTPN22 gene was amplified by PCR using the forward primer 5'-TCA CCA GCT TCC TCA ACC ACA-3' and the reverse primer 5'-GAT AAT GTT GCT TCA ACG GAA TTT A-3' The C→T transition at ... sequencing using the same primers (ABI 7000; Applied Biosystems, Foster City, CA, USA), and was confirmed in all instances For HLA-DRB1 typing, genomic DNA was PCR amplified using two primers specific ... by oligonucleotide hybridization of the PCR products to probes specific for DRB1*01 through *18 Hybridization was performed in a dot-blot format with digoxigenin-11-ddUTP-labeled oligonucleotides...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc
... been shown to reduce the severity of pristane-induced arthritis (an arthritis model) [20] A single nucleotide polymorphism (SNP) in the Ncf1 gene was found to be responsible for the protective ... ROS could be an important regulator of the immune system Materials and methods Selection of single nucleotide polymorphism The HapMap genome browser [32] was used as the primary source for selection ... using the GraphPad Prism software (GraphPad Software, San Diego, CA, USA) Results Fifty-one single nucleotide polymorphisms were successfully genotyped in a Swedish rheumatoid arthritis cohort...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Association of single-nucleotide polymorphisms in RHOB and TXNDC3 with knee osteoarthritis susceptibility: two case-control studies in East Asian populations and a meta-analysis" docx
... protocol was approved by the ethnical committees of the Medical School of Nanjing University, and single nucleotide Page of (page number not for citation purposes) polymorphism (SNP) Research Center ... (0.956) 10 (0.044) Male 258 240 (0.930) 18 (0.070) 498 (0.965) 18 (0.035) OA, osteoarthritis; SNP, single nucleotide polymorphism (P = 0.04; Table 4) No significant association was detected after stratification ... (0.129) Male 258 190 (0.736) 60 (0.233) (0.031) 440 (0.853) 76 (0.147) OA, osteoarthritis; SNP, single nucleotide polymorphism Discussion In RHOB, the minor allele frequency in East Asian individuals...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt
... type C brachydactyly also present with dysplasia of hip joints [18,19] Recently, a functional single nucleotide polymorphism (SNP) in the 5'-untranslated region of GDF5 (rs143383; +104T/C) was ... 0.35 Control CDH = congenital dysplasia of the hip; GDF5 = growth differentiate factor 5; SNP = single nucleotide polymorphism may be due to the limited sample number, although a large sex bias of ... (0.203) 0.75 CDH = congenital dysplasia of the hip; GDF5 = growth differentiate factor 5; SNP = single nucleotide polymorphism Page of (page number not for citation purposes) Arthritis Research &...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: "A statistical approach for detecting genomic aberrations in heterogeneous tumor samples from single nucleotide polymorphism genotyping data" pot
... Kennedy GC, Ogawa S: A robust algorithm for copy number detection using high-density oligonucleotide single nucleotide polymorphism genotyping arrays Cancer Res 2005, 65:6071-6079 Komura D, Shen ... DG, Koeffler HP, Ogawa S: Highly sensitive method for genomewide detection of allelic composition in nonpaired, primary tumor specimens by use of affymetrix single- nucleotide- polymorphism genotyping ... mixed normal-tumour genotypes AA/A, AB/A, AB/ B or BB/B for the single- copy deletion and AA/AAA, AB/AAA, AB/BBB or BB/BBB for the single- copy duplication Moreover, as the normal DNA content increases,...
Ngày tải lên: 09/08/2014, 22:23
Rapid detection of epidermal growth factor receptor mutations with multiplex PCR and primer extension in lung cancer pdf
... mixture was subjected to 25 single- base extension cycles consisting of a denaturing step at 96°C for 10 sec, and primer annealing and extension at 60°C for 35 sec After cycle extension, unincorporated ... variants with primer extension is based on the high accuracy of nucleotide incorporation catalyzed by a DNA polymerase Current products of the thermostable enzymes used in primer extension have ... unincorporated deoxynucleotide triphosphates, using the PCR-M™ Clean Up System (Viogene-biotek Co., Sunnyvale, CA, USA) After removing the primers, the products were subjected to primer extension analysis...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: "RRM1 single nucleotide polymorphism -37C®A correlates with progression-free survival in NSCLC patients after gemcitabine-based chemotherapy" potx
... performed, followed by direct sequencing Primer pairs were designed based on the published RRM1 sequence (GenBank accession number AF107045): -37C®A primers, F-5’-TTAACCGCCTTTCCTCCG-3’ and R-5’GGGATTTGGATTGTTGCG-3’; ... 30 cycles of denaturation at 94°C for 30 s, annealing at 56° C for 30 s, and extension at 72°C for 30 s, with a final extension at 72°C for PCR products were purified using a QIAquick Gel Extraction ... Biosystems) The reaction mixture contained μL of PCR products, 1.6 μL of forward and reverse primers (same as PCR primers), H2O (1.4 μL), and Bigdye (1 μL) The reaction mixture was denatured at 96°C...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt
... to incorporate into DNA extension products Four different dyes were used to identify the A, C, G, and T extension reactions using an argon laser PCR Forward and reverse primers to amplify DNA ... disease and ulcerative colitis susceptibility is the multidrug resistance transporter (MDR1) A single nucleotide polymorphism (SNP) in the coding region of the gene (Ala893Ser/Thr) has been found ... of the SNP of interest were designed using the Primer QuestSM (Integrated DNA Technologies (IDT), Coralville, IA) program and ordered from IDT The primer sequences are: (F) 5'TTC TCT GAG CAG CTC...
Ngày tải lên: 11/08/2014, 10:23
báo cáo khoa học: " Ethical issues raised by common copy number variants and single nucleotide polymorphisms of certain and uncertain significance in general medical practice" potx
... results would be one alternative Testing for genotypes underlying a single gene disorder For genotypes conferring a diagnosis of a single gene disorder, such as factor V Leiden or hemochromatosis, ... variant, HNPCC, hereditary non-polyposis colon cancer; FDA, Food and Drug Administration; SNP, single nucleotide polymorphism Governmental regulation There are two areas in which the role of government ... doi:10.1186/gm163 Cite this article as: Beaudet AL: Ethical issues raised by common copy number variants and single nucleotide polymorphisms of certain and uncertain significance in general medical practice Genome...
Ngày tải lên: 11/08/2014, 12:20
báo cáo khoa học: " Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis)" potx
... The primers are masslabeled so that each product has a unique mass During the extension reaction, a second PCR step, a masslabeled nucleotide is then added in the SNP position, with each nucleotide ... http://www.biomedcentral.com/content/supplementary/1471-2229-1013-S1.DOC ] Additional file 2: Sequenom PCR primers List of all primers used for Sequenom reactions, given in 5’-3’ orientation Extension primers for mass spectrometer readings not shown ... and recombination rates using single nucleotide polymorphisms Genetics 2000, 154:931-942 37 Wakeley J, Nielsen R, Liu-Cordero SN, Ardlie K: The discovery of singlenucleotide polymorphisms and...
Ngày tải lên: 12/08/2014, 03:21
báo cáo khoa học: " Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach" docx
... quantitative traits A Single Nucleotide Polymorphism (SNP) is a unique nucleotide base difference between two DNA sequences In theory, SNP variations could involve four different nucleotides at a ... independently the loci surveyed aNucleotide polymorphism and nucleotide diversity obtained with the complete set of 28 genes studied in Table b Nucleotide polymorphism and nucleotide diversity obtained ... feb252001/524.pdf] Kwok PY: Methods for genotyping single nucleotide polymorphisms Annu Rev Genomics Hum Genet 2001, 2:235-258 Rafalski A: Applications of single nucleotide polymorphisms in crop genetics...
Ngày tải lên: 12/08/2014, 05:20