4 creating a standby database with the same directory structure

... at the standby database s Role Management Services Change the role of a database from a standby database to a primary database, or from a primary database to a standby database using either a ... applying the redo to the standby database Similar to a primary database, a standby database can be either a single-instance Oracle database or an Oracle Real Application Clusters database A standby ... database A standby database can be one of two types: a physical standby database or a logical standby database If needed, either type of standby database can assume the role of the primary database and...

Ngày tải lên: 17/01/2014, 06:20

... the room and extract an account database from a server by using a boot startup disk or CD The attacker could then perform a brute force attack on the password hashes in the database and access ... from the reception area to the mailroom and from the hallway to the mailroom are not equipped with card scanners Private branch exchange (PBX) and wide area network (WAN) room The room has an adjoining ... potentially obtain information about your internal network If data cables are accessible, attackers can tap into them or attach listening devices that gather network data Not all information is...

Ngày tải lên: 21/12/2013, 19:15

... Logical Standby Database • Configure the database guard to control user access to tables • ALTER DATABASE GUARD command keywords: – ALL: prevents users from making changes to any data in the database ... Logical Standby Database Perform the following steps on the primary database before creating a logical standby database: Check for unsupported data types Be aware of unsupported DDL commands ... Objectives After completing this lesson, you should be able to the following: • Explain the advantages of SQL Apply • Explain when to use a logical standby database • Create a logical standby database...

Ngày tải lên: 09/12/2013, 16:15

... AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part of the ... gene and its association with essential hypertension and left ventricular hypertrophy in the Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The PCR products...

Ngày tải lên: 26/10/2012, 10:04

... @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + fileName + ";"; // Use ADOX to create the Access database ADOX.Catalog cat = new ADOX.Catalog( ); try { cat.Create(connectString); } finally { cat = null; } } Discussion ADO ... in a database You can use ADOX from NET through COM interop to create a new Microsoft Access database Use the Create( ) method of the ADOX.Catalog object, passing a connection string for the ... Access database " + fileName + " created.", "Create Access Database" , MessageBoxButtons.OK, MessageBoxIcon.Information); } catch (System.Exception ex) { MessageBox.Show("Could not create database...

Ngày tải lên: 24/12/2013, 05:15

... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... the same as the source database server, so an Oracle table could be synchronized to reflect all changes made to a SQL Server table In fact, the data sources not even have to be databases If the ... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled...

Ngày tải lên: 21/01/2014, 11:20

... statement in a similar way To drop the database created in the previous example, use the following code: DROP DATABASE MyDatabase The DROP DATABASE statement will fail if the database is in use; therefore, ... objects are defined using DDL The solution executes a DDL CREATE DATABASE statement to create a new database on a SQL Server You can programmatically drop the database by using the DROP DATABASE statement ... respectively These statements generally require DBA permissions to execute Database Management Language (DML) Used to manipulate—select, insert, update, and delete—data in the database objects Database...

Ngày tải lên: 21/01/2014, 11:20

... database, you can iterate through the collection of DataRelation objects for the DataSet and use the ALTER TABLE statement with the ADD CONSTRAINT command and a FOREIGN KEY argument to add the ... of the EXISTS query to the calling application and use that to control whether the new table is created The second DDL command uses the CREATE TABLE statement to create the table in the database ... primary keys can easily be added to the CREATE TABLE command, the easiest way to handle compound keys is by using an ALTER TABLE statement with an ADD CONSTRAINT statement and PRIMARY KEY argument...

Ngày tải lên: 21/01/2014, 11:20

Ngày tải lên: 25/01/2014, 05:20

... database is the first step in managing a database system – – – – Define the purpose of the database Define the type of the database Outline a database architectural design Choose the database name ... Creating a Database Manually • • • • • • Choose a unique instance and database name Choose a database character set Set operating system variables Create the initialization parameter file Start ... specific ways of creating a database: – Use the Database Configuration Assistant to create a database using graphical steps Launched by: Start > Programs > Oracle-OraHome90 > Configuration and Migration...

Ngày tải lên: 15/03/2014, 17:20

... of database, and the type discussed here, is a relational database A relational database is a collection of tables with relationships A database is designed to describe a situation A situation ... the physical database in Microsoft Access Concepts of Creating a Database A database is a collection of information typically stored on a computer A database can be thought of as an electronic ... support and information management systems A database can be developed that is a collection of tables with relationships that represent the situation above and store LCTA data A database will contain...

Ngày tải lên: 16/03/2014, 16:20

... programs On the other hand, feedback from front- line paid care workers and volunteers reflected that the linkage between hospitals and social welfare agencies was inadequate (Department of Social ... Work and Social Administration, HKU, 1998) Indeed, the varying needs of elderly with chronic illness demand a multidisciplinary collaborative approach among different professionals and organizations ... reciprocal interactions between the elderly and their social environment are likely to influence their adaptability, access to information, and motivation to seek help from others Formal and informal...

Ngày tải lên: 22/03/2014, 14:20

... this For the lighting I have used an Omni light, V-ray shadows cheked and on V-ray shadows parameters check Transparent shadows and area shadow Use a plane for the scene and assign a white color ... If you wish to make the bottom of the glass thicker just select the bottom of the glass and drag it down I have modified the shape of the glass by using the Taper tool from the Modifiers list ... choose V-ray renderer Not fancy rendering settings, just in the V-ray: Image Sampler(Antialising), turn of the Adaptive subdivision For the glass materials use this settings: and for the liquid...

Ngày tải lên: 01/04/2014, 17:32

... save it The Data Controls page provides data-aware controls that work with data in a database and build a user interface You’ll display the database in a grid and add a few commands and a navigation ... simplifies the development and maintenance of actual database applications Database applications include three main parts: the user interface, a set of data access components, and the database itself ... and post data to the database The data access components include the data source, the client dataset, the data provider, a unidirectional dataset, and a connection component The data source acts...

Ngày tải lên: 16/04/2014, 11:13

... application Other database applications have a similar architecture The user interface includes data-aware controls such as a grid so that users can edit and post data to the database The data access ... a database and build a user interface You’ll display the database in a grid and add a few commands and a navigation bar Creating the grid and navigation bar To create the interface for the application: ... to allow data to be passed to your application Creating a CLX database application Designing the user interface A data source connects the client dataset with data-aware controls Each data-aware...

Ngày tải lên: 16/04/2014, 11:16

... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write ... Installing Joomla! 1.6 requires a series of steps on a Webserver Ǡ A MySQL database with a username, password, and database name is required Ǡ The database is created via the Website control panel ... Create a category in the Category Manager Create an article and assign it to the category in the Article Manager Create a menu link item to the article in a menu You can generate content on a...

Ngày tải lên: 29/05/2014, 23:54

... (Taiwan) Dog Hamam (Japan) (15) Dog Hamam (Japan) Dog KDK1 (Japan) (16) Dog KDK1 Dog Ueno (Japan) (17) Dog Ueno (Japan) Dog Yanaka (Japan) (18) Dog Yanaka (Japan) Giant panda (China) (19) Giant ... USA) (9) Raccoon (Michigan, USA) A7 5/17 (10) A7 5/17 Dog (Colorado, USA) (11) Dog (Colorado, USA) Javelina (12) Javelina Raccoon dog T dog Tanu (13) Raccoon anu (Japan) (Japan) Dog (T aiwan) (14) ... mortality in large felids [2], fresh-water seals (Phoca sibirica) [3], and various other animals CDV killed more than 10,000 Caspian seals (Phoca caspica) in year 2000 [4], and decimated an African...

Ngày tải lên: 18/06/2014, 22:20

... individual achievements are great, collaborative ideas and practices are what create a team-building culture Encourage team members to work together to come up with the very best ideas, and reward them ... team works together directly affects the productivity of the company With an overall understanding of where strengths and weaknesses vary, managers are now able to make appropriate adjustments ... Communicating a clear vision of the future is crucial Engaged employees require a work culture that is fundamentally stimulating, a return on the investment they are making in your company and leadership...

Ngày tải lên: 28/06/2014, 13:20