... 5-CTCCAATCAGGCTTCTCT-3, R 5-TCAGTATCTCGCAGTTCC-3); TLR3 (F 5-GCATTCGGAATCTGTCTCTG-3, R 5-ATTCCTGGCCTGTGAGTTCT-3); TLR4 (F 5-GATGCCAGGATGATGTCT-3, R 5-CCGCAAGTCTGTGCAATA-3); TLR9 (F 5-TACCTTGCCTGCCTTCCTAC3, ... Page of 10 (page number not for citation purposes) Virology Journal 2007, 4:133 tion of rabbit antibody) for h at 37°C The treated supernatants were then transferred to fresh 24-well culture plates ... that stimulation through TLR can induce an antiviral state in cells or in animals [11] For example, replication of HSV-2 in vaginally-infected mice was prevented by intra-vaginal application of...
Ngày tải lên: 20/06/2014, 01:20
... expression of IFN-γ-regulated, but not IFN-I-regulated, genes is enhanced in both splenocyte subsets and kidneys of MRL/lpr mice, suggesting that the type II IFN pathway rather than the IFN-I pathway ... clearance of apoptotic debris is a common feature of human SLE [57] Therefore, disease pathogenesis in the pristane model recapitulates several key features of human SLE, including kidney pathology, ... expression of IFN-I-inducible genes [22] These same genes are overexpressed in blood cells from human lupus patients, and expression of these genes correlates with the production of anti-nucleoprotein...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Nontypeable Haemophilus influenzae induces COX-2 and PGE2 expression in lung epithelial cells via activation of p38 MAPK and NF-kappa B" pps
... to have proinflammatory effects on the pathogenesis of several inflammatory diseases including rheumatoid arthritis and periodontitis [7,8] However, increasing evidence demonstrated that pulmonary ... understanding of the role of pulmonary endogenous anti -inflammatory mediators such as PGE2 and their regulation will bring new insight and develop novel treatment aiming at immune modulation Methods Materials ... of NF-kappa B was not affected by pretreatment of specific p38 MAPK inhibitor SB203580 These data indicate that p38 MAPK and NF-kappa B are two independent signal pathways in the regulation of...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo khoa học: Human lactoferrin activates NF-jB through the Toll-like receptor 4 pathway while it interferes with the lipopolysaccharide-stimulated TLR4 signaling potx
... pathway’ that is initiated by the activation of the IjB kinase (IKK) complex that is composed of two catalytic subunits – IKKa (also known as IKK1) and IKKb (also known as IKK2) – and a regulatory ... phosphorylation-induced degradation of IjB, was activated in response to hLF (Fig 1C, top panel) These results suggest that hLF can stimulate the ‘canonical pathway’, leading to the activation of the ... mechanism of how LF activates the intracellular signaling pathway to induce the production of these cytokines remains to be elucidated At the surface of cells, molecules should exist that bind...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Phosphorylation of NF-jB proteins by cyclic GMP-dependent kinase A noncanonical pathway to NF-jB activation potx
... Substrate phosphorylation of p49 or p50 depends on the presence of PKG and is enhanced by the addition of cGMP, whereas cGMP in the absence of the kinase does not mediate measurable incorporation of ... incubated at room temperature for 20 before separation on a native 4% polyacrylamide gel For supershift, the appropriate antibodies (0.05– 0.1 lg) were incubated with the nuclear extracts for 10 at ... protein) of lyzate The protein concentrations were determined by the BCA protein assay reagent kit (Pierce) As confirmation of protein expression, 20 lg of the same lyzates were also used for separation...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo y học: "Differential Constitutive and Cytokine-Modulated Expression of Human Toll-like Receptors in Primary Neutrophils, Monocytes, and Macrophages" docx
... CTGCAAGCTGCGGAAGATAAT, TLR2; AGAGTTTCCTGCAATGGATCAAG, TLR4; GGCTTAATCACACCAATGTCACTATAG, TLR5; and TCTGAAGACTTCAGGCCCAACT, TLR9 for forward primers, and GCAGCTCTCAGATTTACCCAAAA, TLR2; TTATCTGAAGGTGTTGCACATTCC, ... pro -inflammatory cytokines rather than TLR-ligand binding per se The results of our study demonstrate that several pro -inflammatory cytokines contribute to the regulation of TLR expression Of the ... determine relative expression of TLRs normalized to the expression of 18s Repeated measures ANOVA was used for statistical analysis * indicate statistical significance with P
Ngày tải lên: 08/08/2014, 16:23
Báo cáo y học: "No evidence of major effects in several Toll-like receptor gene polymorphisms in rheumatoid arthritis" pdf
... rheumatoid synovium [8], suggesting that innate immunity may be involved in initiating the inflammatory process or in inhibiting regulation mechanisms that normally prevent chronic inflammation ... (reference genomics) but at position +3483 of the gene (+1 being at the beginning of exon instead of exon 2) SNP2 is a C/T polymorphism that constitutes a noncoding mutation, probably at position ... publicity of available data As we did not observe a large effect it seems that an association between polymorphisms of other TLR genes and RA and/or a functional role for TLR genes in the pathogenesis...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "No evidence of major effects in several Toll-like receptor gene polymorphisms in rheumatoid arthritis" ppt
... rheumatoid synovium [8], suggesting that innate immunity may be involved in initiating the inflammatory process or in inhibiting regulation mechanisms that normally prevent chronic inflammation ... (reference genomics) but at position +3483 of the gene (+1 being at the beginning of exon instead of exon 2) SNP2 is a C/T polymorphism that constitutes a noncoding mutation, probably at position ... publicity of available data As we did not observe a large effect it seems that an association between polymorphisms of other TLR genes and RA and/or a functional role for TLR genes in the pathogenesis...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: "The role of toll-like receptors in acute and chronic lung inflammation" pdf
... thereby decreasing the production of IL-6 and other Th1 proinflammatory mediators that are required for bacterial clearance [199] Antibiotic treatment of asthmatic patients infected with M pneumoniae ... to lung inflammation and protective immunity, the precise nature of gene-environment interactions in asthma pathogenesis, the molecular mechanisms that negatively regulate the innate immune response ... intracellular localization or recognition of distinct ligand signatures, evidence was gathered in support of the hypothesis that endogenous host molecules termed danger associated molecular patterns (DAMPs)...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Early Characterization of Toll-like receptors in primary lung epithelial cells: strong impact of the TLR3 ligand poly(I:C) on the regulation of Toll-like receptors, adaptor proteins and inflammatory response" ppt
... 5'-GCACTTTTATCAATTGGCTTAATCAC-3' 5'-AACGAGTCAGGGTACACACAATATATG-3' 5'-CAATGTCACTATAGCTGGGCCTCCTGCAG-3' 5'-CAGTGCTCTTACCCAGATGGA-3' 5'-TCTGATAATCGATGACAGACTTCA-3' 5'-CTGCCTGTGTTTCAATTCACGAAGCT-3' FP: ... Sequence 5'-CCCATTCCGCAGTACTCCATT-3' 5'-TTTCCTTGGGCCATTCCA-3' 5'-CAGTTATCACAAGCTCAAAAGTCTCATGGCCA-3' 5'-TGTGAAGAGTGAGTGGTGCAAGT-3' 5'-ATGGCAGCATCATTGTTCTCAT-3' 5'-TGAACTGGACTTCTCCCATTTCCGTCTTTT-3' ... source of cytokine, chemokines and other inflammatory mediators that affect the adaptive and innate immune response and therefore modulate inflammatory diseases like COPD or asthma [2] The innate...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " Differential expression of Toll-like receptors on human alveolar macrophages and autologous peripheral monocytes" pdf
... LPS-induced IL-10 production was associated with a reduced capacity to activate STAT3 This suggested that TLR ligand activation may modulate the anti -inflammatory activity of IL-10 either by altering its ... monocytes was set as 1, and the TLR mRNA expression of the ligand-stimulated cells reported relative to that of the unstimulated cells Statistical analysis Data were analyzed using the non-parametric ... 2010, 11:2 http://respiratory-research.com/content/11/1/2 relative to that of monocytes The expression of TLR2, TLR4 and TLR9 mRNA of alveolar macrophages was lower than that of autologous monocytes...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "Trapped in a vicious loop: Toll-like receptors sustain the spontaneous cytokine production by rheumatoid synoviu" doc
... Paper presented at: 73rd Annual Scientific Meeting of the American College of Rheumatology/Association of Rheumatology Health Professionals; 20 October 2009; Philadelphia, PA Presentation 1897 14 ... receptors and their relative roles in subpopulations of patients with RA is just the dawn of TLR-targeted therapy Abbreviations IFN-γ, interferon-gamma; IL, interleukin; RA, rheumatoid arthritis; SCID, ... CL: Rheumatoid arthritis is a heterogeneous disease: evidence for differences in the activation of the STAT-1 pathway between rheumatoid tissues Arthritis Rheum 2003, 48:2132-2145 Page of 15 Sutmuller...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: " Toll-like receptors in cellular subsets of human tonsil T cells: altered expression during recurrent tonsillitis" ppsx
... signaling pathway that leads to activation of nuclear factor κB (NF-κB) transcription factors and members of the MAP kinase family [19,20] This activation does not only initiate innate immune ... in cellular subsets of human tonsil T cells at both mRNA and protein level The ability of TLRs to recognize PAMPs and to activate pro -inflammatory mechanisms might be of great importance for immune ... cultivation test) The control group consisted of 21 patients who underwent tonsillectomy because of tonsillar hyperplasia (no history of recurrent tonsillitis, negative cultivation test) None of...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo y học: " Science review: Key inflammatory and stress pathways in critical illness – the central role of the Toll-like receptors" ppsx
... through very different pathways, contribute to the development of shock in sepsis A third inflammatory cytokine, IL-1, has also been implicated in the pathogenesis of inflammation and shock [20,21] ... mutation: the positional cloning of Lps and its identification as Tlr4 Since that time, at least one new mutation that abolishes much of the endotoxin response has been identified This mutation ... activates a rather different collection of genes through interaction with Janus kinase (JAK) family tyrosine kinases, which in turn phosphorylate members of the STAT (signal transducer and activator...
Ngày tải lên: 12/08/2014, 19:21
The role of downstream of kinase (DOK) 3 in toll like receptor signalling
... mediated activation of RIG-I is possible because of the presence of 5‟triphosphate (5‟PPP) cap or an attachment to the end of the RNA nucleic acid that allows discrimination from the host innate immune ... ligase catalyses both K48 and K63-linked ubiquitination, a form of protein post-translational modification, of which either leads to degradation of target protein via the proteasome or mediates ... K63-type polyubiquitlation of the regulator IKK and activation of the kinase TAK1, a prerequisite for the activation of the IKK complex These events result in the degradation of the NFB inhibitor...
Ngày tải lên: 09/09/2015, 10:16
báo cáo hóa học: " Toll-like receptors in cerebral ischemic inflammatory injury" pdf
... activation of the proinflammatory transcription factor NF-B, and induction of inflammatory cytokines such as TNF-a, IL-1b, and IL-6 have been demonstrated [46] Suppression of the normal inflammatory ... endosomal location of the complex, the phosphorylated IRAKs are able to bind TRAF3 in addition to TRAF6 Activation of TRAF3 leads to phosphorylation, dimerization, and nuclear localization of the transcription ... a central role in innate Page of 11 immunity, recognizing both pathogen- and damageassociated molecular patterns, and have been implicated in a range of neuronal inflammatory processes Toll-like...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo y học: "Toll-like receptors and innate immune responses in systemic lupus" docx
... death’, in the sense that an important feature of this regulated process is to allow effective disposal without immune activation Antiinflammatory effects of apoptotic cells are mediated through phagocyte ... systemic lupus erythematosus The parallel discoveries of the role of TLRs in stimulating type I IFNs, of pDCs as the primary source of this cytokine, and of the IFN-signature in lupus patients by microarray ... effects of TLR activation in these cell types (autoantibody and IFN production) are clearly implicated in SLE pathogenesis Toll-like receptor activation of B cells Normal individuals have circulating...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Toll-like receptors and NOD-like receptors in rheumatic diseases" pdf
... which is able to induce maturation and secretion of proinflammatory cytokines IL-1β and IL-18 [7] Gain of function mutations in the NALP3 gene leading to elevated levels of processed IL-1β cause ... subacute inflammatory arthritis develops in 60% of individuals not treated at the time of the tick bite, and is associated with invasion of the joint tissue by spirochetes Immune responses of the ... severe arthritis – suggesting an antiinflammatory role for TLR2 in this model A lack of TLR9 did not affect the progression of arthritis The anti -inflammatory nature of TLR2 in the IL1-receptor antagonist...
Ngày tải lên: 09/08/2014, 14:21
Báo cáo y học: " Gut flora enhance bacterial clearance in lung through toll-like receptors 4" docx
... peroxide The rate of change in absorbance at 460 nm was measured over One unit of MPO activity was defined Page of as the amount of enzyme that reduces μmole of peroxide per and the data were expressed ... signaling mechanisms that are dependent on activation of the NF-B pathway [22] Inflammatory signaling through the NFB pathway by airway epithelial cells critically regulates the innate immune response ... homogenate was sonicated on ice and centrifuged for 30 at 3,000 g, 4°C An aliquot (0.1 ml) of supernatant was added to 2.9 ml of 50 mM potassium phosphate buffer (pH 6.0) containing 0.167 mg/ml of...
Ngày tải lên: 10/08/2014, 10:20