3impact of a lower primary surplus

... Rytkonen H, Farin P, Ala-Opas M, Soimakallio S: A primary carcinoid tumor of the kidney: a case report and review of the literature Abdom Imaging 1996, 21:464-467 Romero FR, Rais-Bahrami S, Permpongkosol ... JB: Primary malignant neuroepithelial tumors of the kidney: a clinicopathologic analysis of 146 adult and pediatric cases from the National Wilms' Tumor Study Group Pathology Center Am J Surg Pathol ... but negative for Fontana-Masson Metastases were present in 50% of cases with paraaortic and hilar lymph nodes being the most common locations Liver metastases occurred in 34% of cases Metastases...

Ngày tải lên: 09/08/2014, 07:21

... particular, I would like to thank Albertus Hendrawan, Huang Weiwei, Tan Boon Hwa, Syeda Mariam Ahmed, Mohan Gunasekaran, Peng Chang, Chen Nutan, Feng Xiaobing, Chao Shuzhe, Chanaka Dilhan Senanayake, ... 2.3 Summary In this chapter, we gave an overview of lower extremity exoskeleton research in a range of applications The advantages and disadvantages of several types of control methods are also ... motion of the device should be at least equal to the human range of motion during gait rehabilitation and activities of daily living (ADL) These data can be found by examining of clinical gait analysis...

Ngày tải lên: 09/09/2015, 11:13

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also made in the child DataTable This is the default None ... in the Orders table that also has a CustomerID of J6COM A copy of this row is stored in a DataTable named ordersDT The customersDT and ordersDT DataTable objects are related to each other using...

Ngày tải lên: 24/12/2013, 01:17

... these early debates there was any of that rancour and animosity which later characterized the proceedings of the Assembly of Lower Canada 'The remains of the old French politeness, and a laudable ... nationality in the midst of Anglo-American colonies and states'; and he quoted with seeming approval the statement of one of the Lower Canada 'Bureaucrats' that 'Lower Canada must be English, at ... fact, that in less than twenty years the population of the United States of America will be greater than that of Great Britain, and that of British America will be greater than that of the former...

Ngày tải lên: 17/03/2014, 13:20

... participated in the study design, analysis and interpretation of data and drafting the manuscript BM participated in the acquisition of data and the revision of the manuscript All authors read and approved ... additional useful information on patient satisfaction with BPH pharmacotherapy above and beyond what was already provided by global satisfaction A draft of the questionnaire was developed on the basis ... 4):265 Badia X, Garcia-Losa M, Dal-Re R: Ten-language translation and harmonization of the International Prostate Symptom Score: Developing a methodology for multinational clinical trials European...

Ngày tải lên: 18/06/2014, 18:20

... this article as: Cavalieri et al.: Pro-apoptotic activity of a- bisabolol in preclinical models of primary human acute leukemia cells Journal of Translational Medicine 2011 9:45 Page 13 of 13 ... cases (Ph+B-ALL #01, #04, #06 in Table 1) with primary mutation of BCR/ABL, we observed a full efficacy of a- bisabolol In imatinib mesylate-sensitive blasts, the association of a- bisabolol and ... proportion of Ph-B-ALL, and with an IC50 of 45 ± μM in a substantial proportion of both Ph + BALL and AML cases Remarkably, these concentrations spared normal circulating leukocytes and CD34+ and CD33...

Ngày tải lên: 18/06/2014, 19:20

... 99% of the total translational migration The average absolute rotational migration was smaller than 0.04° in the sagittal and frontal planes, but much larger in the transverse plane (rotation about ... resolution was smaller than 0.7 μm in all translational directions, and smaller than 0.001° in rotation The accuracy of the system in measuring translation was evaluated against a micrometer ... hand, in another invitro study, the inclusion of muscle loads (abductor, tensor fascia latae, ilio-tibial tract, vastus lateralis and vastus medialis) increased migration and micromotion of a...

Ngày tải lên: 20/06/2014, 04:20

... References [1] H L Abbott and D Hanson A Problem of Schur and its Generalizations Acta Arithmetica, 20 (1972), 175-187 [2] H L Abbott and L Moser Sum-free Sets of Integers Acta Arithmetica, 11 (1966), ... 10,000 partitions gave us, and found that at least 1500 were represented To construct these partitions one can use any of the well known approximation heuristics for combinatorial optimization ... 10,000 partitions are all “close” to each other In other words, one can begin with one of the partitions, move an integer from one set to another, and obtain a new partition This can be contrasted...

Ngày tải lên: 07/08/2014, 06:20

... author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R Murty, Graph Theory with Applications ... [4] Chunhui Lai, Upper bound and lower bound of f (n), J Zhangzhou Teachers College(Natural Science Edition) 4(1)(1990) 29,30-34 [5] Chunhui Lai, On the size of graphs with all cycle having distinct ... Applications (Macmillan, New York, 1976) [2] Y Shi, On maximum cycle-distributed graphs, Discrete Math 71(1988) 57-71 [3] Chunhui Lai, On the Erd¨s problem, J Zhangzhou Teachers College(Natural Science...

Ngày tải lên: 07/08/2014, 06:22

... dna ,tnanimod saw xirtam diordnohc a ,esac siht fo noitanimaxe lacigolohtapotsih eht nO xirtam dioetso dna diordnohc a sniatnoc yllacigolotsih ti dna evah samocrasordnohc sa ecnaraeppa IRM dna ... drehpehs namreG a fo arhteru eht ni samocrasordnohc owT D tloH ,JG sivaD 6991 ,aihpledalihP ,srednuaS ,035-724 pp de dn2 txeT dna saltA citsongaiD a :yhpargonosartlU dna ygoloidaR laminA llamS M namrekcA ... nosirapmoc ni ,muinarc eht gnidulcni ,daeh eht no samocrasordnohc fo stroper rewef era erehT ]3[ earbetrev lacivrec dna allixam eht ,ytivac lasan ,sesunis lasanarap ,senob waj eht sa detroper ylbairav...

Ngày tải lên: 07/08/2014, 20:23

... change genus of such a surface Operation 1: Aaa− ∼ A, Operation 2: AabBab ∼ AcBc, Operation 3: AB ∼ {(Aa), (a B)}, a A A a b c A B a b a A B A B A c c B c Figure 4: Operation 1, Operation and ... following relation [17, 19] Relation 1: AaBbCa− Db− E ∼ ADCBEaba− b− Proof By Property 2.1, AaBbCa− Db− E ∼ Db− EabCBa− A = EabCBa− ADb− ∼ ba− ADCBb− Ea ∼ a b− EADCBab = aba− b− EADCB ∼ aba− b− ADCBE ... number of graphs in the sequence can be obtained by attaching ears serially or by bar-amalgamation of a cactus to GN Proof Suppose the values of the average genus of the graphs approach a finite...

Ngày tải lên: 08/08/2014, 12:23

... leaf photosynthetic activity and physiological modification before leaf fall At the end of the leaf span, global respiration rate of the stand was higher than the assimilation rate of the canopy, ... associated with stomata becoming increasingly plugged with cuticular wax reduced the daily net canopy assimilation rates for ; C0 4) January-February: soil water availability was the main factor respons- ... micrometeorological methods (Allen et al., 1974; Saugier and Ripley, 1974), experimental equations have been determined which express the net assimilation rate as a function of stand characteristics in relation...

Ngày tải lên: 09/08/2014, 04:20

... GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRPX TGGCTGGTTGATTTTGTAGAGAAA TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT ... GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA MYBPH AGGCCTACAGTCAAACTCCAGAGA GAAGGGAGGCCAGCAGGTA Page of 10 (page number not for citation purposes) Arthritis Research & ... GATACATGACAAGGTGCGGCT COMP CTGGGCCAACCTGCGTTA CGCAGCTGATGGGTCTCATAG APOD ACGCCCTCGTGTACTCCTGTA TTCCACAAGCACAAACTTTACACAT S10 0A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT RGC32 GACAAAGACGTGCACTCAACCTT...

Ngày tải lên: 09/08/2014, 10:21

... cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial imaging has the advantage of the central and peripheral areas ... Hazama Kenji, Akashi Akinori, Shigemura Norihisa, Nakagiri Tomoyuki: Less invasive needle thoracoscopic laser ablation of small bullae for primary spontaneous pneumothorax Eur Jour Cardio-thoracic ... suspected area was resected The final confirmation of ELCs was based on the pathology reports Axial and coronal HRCT protocol Data analysis The imaging parameters were as follows: 1.0 mm collimation,...

Ngày tải lên: 10/08/2014, 09:21

... of the brachial plexus through a supraclavicular approach on the left side of the 17 year old girl After skin incision and incision of the fascia the brachial plexus (arrow; A) was located very ... only a rudimentary cervical rib was presented on the asymptomatic side the cervical rib should be considered in appropriate cases We advocate a supraclavicular approach with a careful exploration ... when carrying things in the hand, when a pressure was applied supraclavicularly (e.g carrying a backpack) or when working with the hands above the plane of the shoulder Percussion of the area of...

Ngày tải lên: 10/08/2014, 10:20

... developing and investigating alternative predictions Qualitative analysis Procedurally, qualitative data analysis involves three phases: data coding, within-case analysis, and betweenTable 3: Anticipated ... complex innovations and adapted to the context of clinical practice An additional product of this phase of the study is an evaluation of approaches to implementation of the behavioral intervention ... technology: an organizational analysis J Appl Psychol 2001, 86(5):811-24 Pullig C, Maxham JG, Hair JF: Salesforce automation systems - An exploratory examination of organizational factors associated with...

Ngày tải lên: 10/08/2014, 10:23

... recruit a total number of 200 participating patients Insurance claims data analysis Sampling of patients As case finding is crucial for effective care management we will take two different approaches ... as well as care organization contributes to avoidable hospitalizations and to what extent care management may be able to implement strategies that target the revealed mechanisms As implementation ... practitioner or general internist) and a small number of healthcare assistants (HCAs), who have few clinical tasks HCAs are trained in a three-year part-time curriculum in practice and vocational school...

Ngày tải lên: 10/08/2014, 10:23

... Québec, Canada Faculty of Health Sciences, School of Nursing, University of Ottawa, Ottawa, Canada Authors’ contributions AL, who was a doctoral student at the time, participated in all stages of the ... sections: (1) a diagnostic aid for physicians to better appraise the probabilistic nature of the diagnosis of a bacterial versus viral ARI, (2) a graphic display of the benefits and risks of antibiotic ... la Recherche en Santé du Québec F Légaré holds a Tiers Canada Research Chair on the implementation of shared decision-making in primary care practices G Godin holds a Tiers Canada Research Chair...

Ngày tải lên: 10/08/2014, 10:23

... Canada 2Department of Family Medicine, University of Ottawa, Ottawa, Ontario, Canada 3Institute of Population Health, University of Ottawa, Ottawa, Ontario, Canada 4School of Primary Health Care, ... Monash University, Victoria, Australia 5Southern Academic Primary Care Research Unit, Victoria, Australia 6Cardiovascular Research Methods Centre, Ottawa Heart Institute, Ottawa, Ontario, Canada ... each Outreach Facilitator as a separate case, with the individual practices that each Facilitator works with acting as an embedded unit of analysis The qualitative research staff will read and...

Ngày tải lên: 10/08/2014, 11:20