3 physical and chemical composition of the standard atmosphere

Báo cáo lâm nghiệp: "Chemical composition of the periderm in relation to in situ water absorption rates of oak, beech and spruce fine roots" doc

... (mean depth of the entire organic profile, i.e Of+ Oh horizons, is 72 mm) The organic profile is highly acidic with pH values of 3. 0 and 2.6 (in KCl) and Ca2+/H+ quotients of 0.2 in the equilibrium ... soil solution of the upper (Of) and lower organic horizons (Oh), respectively Measurements using the in situ-soil incubation method [33 ] showed that about 85% of the profile total of net nitrogen ... situ and relate them to the contents of suberin and lignin in the root periderm This approach contrasts with earlier laboratory studies on the relationship of radial hydraulic conductivity and the...

10
331
0

09 Physical and Chemical Characteristics of DDGS revisions.

Danh mục: Sinh học

... Density 36 .3 39.2 36 .8 36 .3 33. 5 39 .3 36.1 33 .7 30 .8 31 .8 38 .2 31 .4 35 .9 39 .2 37 .6 35 .1 35 .7 CV % 0.17 0.15 0.11 0. 13 0. 13 0.45 0.22 0.14 0.16 0. 13 0.11 0.14 0.16 0.17 0.07 0.20 0.15 68% of the particles ... 6 03 32 43 661 2644 880 230 9 745 2521 747 2108 2 23 16 83 4 53 2094 740 2 139 621 2101 751 238 0 919 2411 706 2161 641 2240 588 2569 136 2 33 15 510 25 83 697 2406 Two additional DDGS nutrient analysis and ... mean), the coefficient of variation (CV) and 08 - Physical & Chemical Characteristics of DDGS standard deviation (SD) of particle size within and among ethanol plants were calculated These results...

8
748
0

Different physical and chemical pretreatments of wheat straw for enhanced biobutanol production in simultaneous saccharification and fermentation

Danh mục: Hóa học - Dầu khí

... was added to 100 ml of sterilized distilled water in a 200 ml shaker flask The biomass concentration of 2.5, 3. 3, 4.0, and 7.0% were examined by adding 2.5, 3. 3, 4.0, and 7.0 g of wheat straw to ... varied from 2.5 to 5.0% where, 2.5 g and 5.0 g of wheat straw were added The effect of temperature and the effect of combination of xylanase, cellulase, and β-glucosidase were examined during ... flask Then each flask was autoclaved at 135 °C for h which was called water pretreatment After pretreatment, the effect of temperature and the effect of combination of xylanase, cellulase, and β-glucosidase...

12
376
0

Tài liệu PHYSICAL AND CHEMICAL ASPECTS OF ORGANIC ELECTRONIC doc

Danh mục: Cao đẳng - Đại học

... Plötner, and W.-J Fischer 23. 1 23. 2 23. 2.1 23. 2.2 23. 3 23. 3.1 23. 3.2 23. 3 .3 23. 3.4 23. 3.5 Introduction 499 Experimental 500 Preparation 500 Characterisation 500 Results and Discussion 501 Influence of ... States of the Polymer Chain 33 1 Polarons and Bipolarons or Polaron Pairs 33 2 Polarons and Bipolarons 33 2 Polarons and Polaron Pairs 33 3 Polarons, Bipolarons and Polaron Pairs 33 5 16 .3. 2 16 .3. 2.1 ... Pflaum, and M Sokolowski 8.1 8.2 8 .3 Introduction 139 Experimental 140 Results and Discussion 142 Contents 8 .3. 1 8 .3. 1.1 8 .3. 1.2 8 .3. 2 8 .3. 2.1 8 .3. 2.2 8 .3. 2 .3 8 .3. 3 8 .3. 3.1 8 .3. 3.2 8.4 Structural and...

733
2,740
1

Báo cáo " Chemical composition of the leaf oil of Litsea glutinosa (Lour.) C. B. Rob. from Ha Tinh province " pptx

Danh mục: Báo cáo khoa học

... cedrol 1 032 1042 10 53 1061 1090 1100 1102 1104 1128 11 43 11 53 11 63 1165 1180 11 83 1261 12 73 1285 1289 1290 132 7 134 3 136 2 137 4 137 6 138 6 138 9 139 1 1409 1412 1419 1 433 1440 14 43 1447 1454 1474 1 .30 ... Journal of Science, Natural Sciences and Technology 26 (2010) 161-164 negative bacteria The results justify the reported uses in diarrhea and dysentery [9] The BuOH extract of the leaves and twigs of ... 927 931 939 9 53 976 980 990 1006 1011 1017 1026 1028 % FID trace 0 .37 3. 38 0.41 0.29 3. 26 1.91 0.65 0.50 trace trace trace 1 63 N.T Hien et al / VNU Journal of Science, Natural Sciences and Technology...

4
411
2

Báo cáo vật lý: "Physical and Chemical Characteristics of Citrullus lanatus Var. Colocynthoide Seed Oil" pdf

Danh mục: Báo cáo khoa học

... esters The IR spectrum showed two bands at 1470 cm–1 and 138 0 cm–1 as indications for δasCH3 and δsCH3 respectively The bands at 1 230 cm–1 and 1180 cm–1 indicates the presence of acetate C(=O)−O and ... consists of three sharp bands in the region 2850 33 00 cm–1 as indication of O-H stretching bands of the fatty acids carboxylic group The carbonyl band at 1750 cm–1 indicates the presence of aliphatic ... 1.4580 13 13 13 Moisture and volatile matter FFA Colocynth seed Colocynth seed Melon seed 5%–7.5% 0 .35 %–1.5% 0.49%–1 .30 % 9 13 PV Cotton seed Groundnut Sunflower 34 .1 36 .02 23. 0 30 .0 20.87 13 13 Phosphorus...

7
294
0

Báo cáo toán học: "Anatomy and chemical composition of Pinus pinea L. bark" pdf

Danh mục: Báo cáo khoa học

... type of cell change at the outside of the innermost periderm has been observed in P pinaster [9], in southern pines [7] and also in other genera [3] These expanded The chemical composition of pine ... to fracture and determine the external morphology of the rhytidome, which is kept together by the sclerified cells (Scl) of the periderm The rhytidome of P pinea has a high amount of material ... alignment, the distortion of rays and the expansion of parenchyma cells These changes represent the adjustment of the secondary phloem to the radial tree growth, as reported for P pinaster [9] and for...

6
324
0

ENCYCLOPEDIA OF ENVIRONMENTAL SCIENCE AND ENGINEERING - CHEMICAL EFFECTS: see EFFECTS OF CHEMICALS; AIR POLLUTANT EFFECTS; POLLUTION EFFECTS ON FISH CHEMICAL TREATMENT: see PHYSICAL AND CHEMICAL TREATMENT OF WASTEWATERS potx

Danh mục: Điện - Điện tử

... additional demands on the system The construction of a facility will have unavoidable impacts on the land use at the site Construction and operation may impact on the surface water bodies and the potable ... Conservation and Recovery Act RCRA, must be conducted to determine the nature of the solid waste generated by the gasification of the particular coal with the specified process The wastewater ... 20,000 — 35 00 6000 — 260–660 4200–4400 38 00 30 00 130 30 0 8–19

5
439
0

ENCYCLOPEDIA OF ENVIRONMENTAL SCIENCE AND ENGINEERING - PHYSICAL AND CHEMICAL TREATMENT OF WASTEWATERS potx

Danh mục: Điện - Điện tử

... 0.044–0. 438 25 73 340.87 0.44–4 .38 446 511.12 4 .38 47 4 43. 34 Other 38 Total 16204 Source: Adapted from Tchobanoglous et al., 20 03 © 2006 by Taylor & Francis Group, LLC — 1409.68 9 73 PHYSICAL AND CHEMICAL ... reactor and a membrane for the treatment of highorganic-matter-content wastewater The main function of the membrane is the filtration of the effluent and the recycle of the biomass to the reactor ... formation and the factors affecting it; (3) the development of methods of sludge filtration and processing that overcome, in part, the difficulty of greater sludge bulk; and (4) the establishment of the...

18
559
0

Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc

Danh mục: Báo cáo khoa học

... 30 31 32 33 34 35 36 37 proteins from their atomic-level structure Biophys J 78, 719– 730 Minor W, Cymborowski M, Otwinowski Z & Chruszcz M (2006) HKL -30 00: the integration of data reduction and ... dose of radioactivity, and the sum of radioactivities recovered in the individual organs, and in the urine and faeces, was designated as the rest of the body (rest), consisting mostly of the bowel, ... contribution of a buffer was corrected using the standard algorithm [32 ] The spectrum of water vapors was subtracted and ﬁnally the spectrum was normalized The fraction content of the secondary...

18
400
0

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modiﬁed conotoxin, reveals that the glycan structure is a-D-Gal-(1ﬁ3)-a-D-GalNAc pot

Danh mục: Báo cáo khoa học

... 4.82 3. 53 3. 43 3.72 3. 53 3. 43 3.72 Proton (1H) Chemical shift (p.p.m.) Proton (1H) Chemical shift (p.p.m.) GalNAc:H1 GalNAc:CH3 GalNAc:H3 GalNAc:H1 Gal:H2 Gal:H2 4.79 1.79 3. 77 4.79 3. 53 3. 53 10ThrcCH3 ... GalNAc:H3 GalNAc:H3 Gal:H1 Gal:H1 Gal:H2 GalNAc:CH3 GalNAc:CH3 GalNAc:CH3 4.79 3. 77 3. 77 4.82 4.82 3. 53 1.79 1.79 1.79 GalNAc:H2 GalNAc:H2 Gal:H1 Gal:H2 Gal:H3 Gal:H4 Gal:H2 Gal:H3 Gal:H4 3. 95 3. 95 ... within the glycan (Table 2) The 3J2 ,3 coupling constants were 7.92 and 7.84 Hz, respectively, for the GalNAc and Gal monosaccharides Furthermore, the H3 resonance of GalNAc showed a strong NOE to the...

11
563
0

Báo cáo toán học: "Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L." docx

Danh mục: Toán học

... 14.56 26 .32 29.88 31 .17 32 .05 32 . 13 33. 23 36.15 36 .61 36 . 83 37.68 38 .37 45.51 50 .38 56.52 60.98 61. 93 66.81 72 .39 Percentage 0. 13 1.45 7 .31 2.82 0.87 0.19 0.64 0.21 0. 13 0.19 1.04 0.22 2. 93 0.17 ... [4] and the neuropharmacological properties [5] have been investigated as well To the best of the authors’ knowledge, there are no reports about the chemical content and biological effect of the ... order of their elution on the HP-5MS non-polar column (Table 1) A total of 19 compounds were identified, representing 86.68% of the total oil The esters made up the largest component of the oil...

13
455
0

báo cáo hóa học:" Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L." potx

Danh mục: Hóa học - Dầu khí

... 14.56 26 .32 29.88 31 .17 32 .05 32 . 13 33. 23 36.15 36 .61 36 . 83 37.68 38 .37 45.51 50 .38 56.52 60.98 61. 93 66.81 72 .39 Percentage 0. 13 1.45 7 .31 2.82 0.87 0.19 0.64 0.21 0. 13 0.19 1.04 0.22 2. 93 0.17 ... [4] and the neuropharmacological properties [5] have been investigated as well To the best of the authors’ knowledge, there are no reports about the chemical content and biological effect of the ... order of their elution on the HP-5MS non-polar column (Table 1) A total of 19 compounds were identified, representing 86.68% of the total oil The esters made up the largest component of the oil...

13
388
0

Báo cáo hóa học: " Chemical composition and antibacterial activity of the essential oils from Launaea resedifolia L" pdf

Danh mục: Hóa học - Dầu khí

... a-Limonene diepoxide 32 . 13 0.19 (Z)-6-Octen-2-one 33 . 23 0.64 Heptanal 36 .15 0.21 3, 4-Dimethylcyclohexanol 36 .61 0. 13 10 bornyl acetate 36 . 83 0.19 11 caryophyllene oxide 37 .68 1.04 12 1,2-Benzenedicarboxylic ... geographical location and the harvesting period It is noteworthy that the results of this study may be considered as the first report on the composition of the essential oils of this endemic species ... allowed the identification of 86.68% of the total volatile products for L resedifolia and 19 volatile compounds A major constituent in visible parts was Dioctyl phthalate (39 .84%) and the yield of...

4
478
0

Báo cáo lâm nghiệp: "Eﬀects of the clear-cutting of a Douglas-ﬁr plantation (Pseudotsuga menziesii F.) on the chemical composition of soil solutions and on the leaching of DOC and ions in drainage waters" pps

Danh mục: Báo cáo khoa học

... of the soil of the site before the harvest Hor A1 A2 (B) (B)/C Depth (cm) 017 1 737 37 60 6090 pH(H20) Clay 4 .3 4.4 4.4 4.5 24 26 27 14 Silt (%) 39 45 33 39 Sand 37 29 36 47 OM N (%) 6 .3 0 .30 3. 4 ... (1 .3) B 0.0 (0 .3) A 1.0 (1 .3) B 0.0 (0.0) A 2.8 (5.9) A 2 .3 (2.4) A 9 .3 (3. 7) A 4.9 (2.4) B Mg2+ ì (SD) TEST 97 (58) B 60 ( 23) A 1 03 ( 53) B 30 (26) A 80 (41) B 51 (31 ) A 61 (27) A 50 (34 ) A 1 03 ... Changes in the outputs: The uptake by vegetation was strongly modied after the clear-cutting The uptake of the Douglas-r stand disappeared (36 , 3. 3, 19 .3, 25, 3. 4 kg ha1 for N, P, K, Ca and Mg respectively)...

18
416
0

OCEANOGRAPHIC PROCESSES OF CORAL REEFS: Physical and Biological Links in the Great Barrier Reef - Chapter 3 docx

Danh mục: Cao đẳng - Đại học

... 0.82 0 .31 0 .33 0.1 2.5 16.48 Total % Area 0. 13 0.01 0.04 1. 93 0.77 4.94 0 .34 0.24 7.74 0.44 1.57 11.66 1.54 4.15 18.88 3. 62 2. 63 12.04 2.84 13. 99 4.06 5.07 20 .34 6. 43 1. 73 3 .34 21. 83 1 .32 0.47 ... Total (%) 43, 300 2, 130 490 2,180 2,020 2 ,33 0 1,690 1,140 10, 130 1,080 3, 650 129,860 3, 890 2,490 2,440 1,490 11,270 152,640 9,225 36 9,480 Foresta 4 .3 37.7 30 .4 36 .4 16.9 25 .3 62.5 32 .9 9.5 18.0 ... Urbane 3, 288 2,916 4,199 2,847 2,694 3, 886 24 ,31 9 2,0 63 2, 130 490 2,180 2,020 2 ,33 0 10, 130 1,690 1,140 129,860 1,080 1 ,34 6 3, 650 3, 890 2,490 2,440 1,490 2,547 3, 018 3, 698 1,756 152,640 2,204 2,473...

17
291
0

Effect of thickness on the physical, thermal and chemical properties of ultra thin polymer films

Danh mục: Tổng hợp

... investigated the thickness dependence on the thermal, physical and chemical properties of ultra-thin films of selected polymers In the first part of our study, we investigate the thermal and physical ... by analyzing the light reflected from the sample In Figure 2.1, it shows that the amplitude of the electric wave which is in the plane of the incidence as Ep and the amplitude of the electric ... used to probe the chemical shift of the atom relative to the original molecule and hence obtain information of the structure This is due to the variation of the binding energies of electrons in...

76
384
0

Tài liệu NEW AND ORIGINAL THEORIES OF THE GREAT PHYSICAL FORCES doc

Danh mục: Vật lý

... except in the direction of other spheres These theories throw new light upon the character and extent of the atmosphere of the moon and planets, and the consequent availability of those and other ... position at the present day The present theories of the transmission of light and sound; of the production of winds, and sun-spots, and of the method of development and dissemination of heat, are ... The construction of a true philosophy of the physical forces must depend now upon our rightly understanding the modus operandi of the conveyance, and utilization, of these sun-elements, and the...

71
395
1

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

Danh mục: Báo cáo khoa học

... (fold increase) Wild-type K 335 A S53A S53A/K 335 A G56A G56S G56S/K 335 A Q 334 A Q 334 A/K 335 A Q 334 H Q 334 H/K 335 A Q 334 S S53A/Q 334 H G56A/Q 334 S G56S/Q 334 H G56S/Q 334 H/K 335 A 54.7 ^ 13. 5 (16) 76.9 ^ 11.6 (4) ... that the substitutions in positions 53, 56, and 33 4 affect the latency Speciﬁc inhibitory activity Wild-type K 335 A S53A S53A/K 335 A G56A G56S G56S/K 335 A Q 334 A Q 334 A/K 335 A Q 334 H Q 334 H/K 335 A Q 334 S ... Wild-type K 335 A S53A S53A/K 335 A G56A G56S G56S/K 335 A Q 334 A Q 334 A/K 335 A Q 334 H Q 334 H/K 335 A Q 334 S S53A/Q 334 H G56A/Q 334 S G56S/Q 334 H G56S/Q 334 H/K 335 A S/G/Q S/G/Q A/G/Q A/G/Q S/A/Q S/S/Q S/S/Q S/G/A S/G/A...

10
431
0

Báo cáo khoa học: Identiﬁcation and biochemical characterization of the Anopheles gambiae 3-hydroxykynurenine transaminase pot

Danh mục: Báo cáo khoa học

... precipitation HiTrap Q 109 Source Q 28 Mono Q 13. 4 10 .3 6122 .3 100 11.7 31 82.4 52 17.7 26 .3 32.6 1929 .3 736 .4 436 .8 31 .5 12 these, the maximal activity towards both 3- HK and L-KYN was observed with glyoxylate; ... ESTs BM 637 288 and BM6 036 18 representing the putative 5¢-UTR and 3 -UTR of the A gambiae 3- HKT The sequence of the oligonucleotide primers was: hkt1BamF, 5¢-GATCGGATC CTGTTACGGTAGCGGTACCTG -3 ; hkt1EcoR, ... role of XA in the gametogenesis and fertility of the malaria parasite [ 23, 24] Very recently, the molecular details of the signalling cascade triggered by XA and resulting in the maturation of Plasmodium...

10
421
1