... TCCCAGCTACTGGGGAGGCTGAGG GCCTCCCAAAGTGCTGGGATTACAG ATGCCACGTAAGCGAAACT Linear HIV DNAa AA55M MH 531 GCTAGAGATTTTCCACACTGACTAA TGTGTGCCCGTCTGTTGTGT 2-LTR circlea MH 532 HIV F GAGTCCTGCGTCGAGAGAGC GTGCCCGTCTGTTGTGTGTGACT ... GTGCCCGTCTGTTGTGTGTGACT U5-U3 RNAa HIV R HIV F ACTGGTACTAGCTTGTAGCACCATCCA GTGCCCGTCTGTTGTGTGTGACT Gag HIV R For ACTGGTACTAGCTTGTAGCACCATCCA CCCATAGTGCAGAACATCCA Singly splicedb Rev M669 GGGCTGAAAGCCTTCTCTTC ... GGGCTGAAAGCCTTCTCTTC GTGTGCCCGTCTGTTGTGTGACTCTGGTA AC GCCTATTCTGCTATGTCGACACC GACTCATCAAGTTTCTCTATCAAA La 23 Multiply spliced HIV RNAa P659 Unspliced HIV RNAa β-actin GAPDH a Primer b Primer P413MOD AGTCTCTCAAGCGGTGGT...
Ngày tải lên: 13/08/2014, 05:21
... hnRNPs act in a trans-dominant manner to counteract that of SC35 in vitro [19] Taken together these results strongly suggest that changing the hnRNP/SC35 ratio probably leads to activation or ... Retrovirology 2005, 2 :33 http://www.retrovirology.com/content/2/1 /33 A1 5’LTR A4a A4b A4c A3 A5 A2 pol vpr gag D1 vif D2 rev tat vpu D3 A7 tat env rev 3 LTR nef D4 AUG Vpr Vpr AUG Tat Tat Tat ... facilitating the recruitment of U2AF on the PPT [20] It is tempting to speculate that the ratio between hnRNP A/B and ASF/SF2 bound close to site A2 modulates the binding of U2AF at this site This effect...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: "Fully-spliced HIV-1 RNAs are reverse transcribed with similar efficiencies as the genomic RNA in virions and cells, but more efficiently in AZT-treated cells" ppt
... the treatment of HIV infection AZT, after conversion to AZT-5'-triphosphate by cellular enzymes, inhibits RT through a competition with the natural dTTP [6] To further investigate the RTion of ... RT, reverse transcriptase, AZT, Zidovudine, NERT, natural endogenous reverse transcription Competing interests The author(s) declare that they have no competing interests 12 13 14 Zhang H, Dornadula ... U3 cDNA (Fig 1) As shown in Fig 4, and similarly to "Fspl cDNA", AZT has only little effect on the synthesis of these two short RTion intermediates This result suggests that in the infected cells...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo khoa học: Adaptability and flexibility of HIV-1 protease potx
... the S2/S2¢ pocket depend on the substituents at the P2/P2¢ site These substituents point directly towards the polypeptide segment 27 32 of the S2/S2¢ subsite The allyl substituent at this site ... in the structure near the mutation site [3] Instead it affects the catalytic site residues 23 26 thereby suggesting that the residues 23 26 are more adaptable than residues around 95 Hence it ... protease structures are superimposed the Rmsd is ˚ greater than 1.0 A, with changes being distributed throughout the protein This might suggest that concerted changes distributed throughout the...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo hóa học: " A predominance of R5-like HIV genotypes in vaginal secretions is associated with elevated plasma HIV-1 RNA levels and the absence of anti-retroviral therapy" docx
... be transmitted [14] These observations suggest that ART effectively controls the expression of R5like genotypes in the vaginal compartment http://www.virologyj.com/content/5/1/87 Authors' contributions ... significant implications for HIV transmission Genotypes that utilize the CCR5 coreceptor are most commonly transmitted in both sexual and mother-to-infant transmission [14] This collective data suggests ... compartmentalized replication of virus in the genital mucosa [5,7,8] To evaluate the properties of HIV expressed in the genital tract and the potential impact of ART on genital tract viral genotypes, we measured...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" The HIV-1 Non-subtype B Workgroup: An International Collaboration for the Collection and Analysis of HIV-1 Non-subtype B Data" pot
... resistance As treat- http://www.jiasociety.org/content/7/1/71 ment efforts increase, data on non-B resistance patterns will be useful to test the hypothesis that the knowledge acquired in subtype B ... Despite intensive studies, it has been difficult to identify clear differences between the group M subtypes and CRFs with respect to pathogenesis, transmission, or drug susceptibility Host genetics, ... resistance interpretation algorithm that significantly predicts therapy response in HIV-1infected patients Antivir Ther 2002, 7:1 23- 129 Abstract Meynard JL, Vray M, Morand-Joubert L, et al.: Phenotypic...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf
... fragment is expected The following primers were used: 1, Forward Tar: 5'-GCAATGATGTCGTAATTTGC and 2, Reverse Tar: 5'-CTTGCTCAGTAAGAATTTTCGTC HIV-1 infection of thymocytes Thymocytes derived from thy/liv ... infection These results showed for the first time that expression of these transgenes in combination not interfere with normal thymopoiesis and thus have set the stage for their application in stem ... the transactivation response element (Tar), present at the 5'-end of all HIV-1 transcripts [1] In the absence of Tat, only short ineffective transcripts are generated Tat is also known to interact...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Clade, Country and Region-specific HIV-1 Vaccines: Are they necessary" pptx
... sufficient to target all clades The latter point is supported by studies of HIV-1-infected humans and SIV-infected macaques Although infected subjects cannot clear endogenous virus (due to its sequestration ... and Therapy 2005, 2 :3 such an undertaking and the many difficulties that attend it encourage a second look at the strategy Review of the scientific literature may provide reassurance that the ... discriminate between them This discrimination may be due to a single amino acid change within the receptor contact site or in a sequence that alters epitope display [15,16] Thus it is the detail of...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx
... proviral quantity by to log10 into all primary cells tested, suggesting that its antiviral activity is mostly due to its capacity to inhibit the entry of HIV-1 into T cells and may limit the ... (5'-GCCTCAATAAAGCTTGCCTTGA -3' ) and exonuclease probe (5'FAM-AAGTAGTGTGTGCCCGTCTGTTRTKTGACTTAMRA -3' ) designed to amplify a fragment in the long terminal repeat (LTR) gene Reverse transcription and amplification ... DCs Taken together, these data strongly suggest that C14 could alter the infectiousness of viruses, inhibiting the entry of viruses into T cells and interfering with the HIV-1 reverse transcriptase...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy" pptx
... infected on ART with detectable plasma viral load) These results suggest that CD4+ T cells were shed from GALT to intestinal lumen in the infected subjects with detectable plasma viral load Detection ... GGC CAT ATC ACC TAG AAC TTT AAA TGC ATG G 1st round PCR primer for HIV Gag Gag outside R CCT ACT GGG ATA GGT GGA TTA TTT GTC ATC CA 1st round PCR primer for HIV Gag Gag inside F GGC ACA TCA AGC ... CCT TGG TGG GTG CTA CTC CTA ATG GTT CA 1st round PCR reverse primer for HIV env gp120 DR7 TCA ACT CAA CTG CTG TTA AAT GGC AGT CTA GC 2nd round PCR forward primer for HIV env gp120 DR8 CAC TTC TCC...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: "PVP-coated silver nanoparticles block the transmission of cell-free and cell-associated HIV-1 in human cervical culture" ppsx
... that is active against a wide range of pathogens, it is potentially cytotoxic to host cells In contrast to these compounds, PVPcoated AgNPs have low cytotoxicity, protect cervical tissue against ... washed thoroughly; after this period of time, the HIV-1 was added to the cervical explant at different times until 72 hours to evaluate the duration of protection to the tissue (Fig 5) These results ... brane, [36 ,69] and may protect the natural barrier of the genital epithelium, therefore inactivating the ability of the HIV virus to reach the target cells that reside below Thus, when the HIV...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " Synergistic effect of human CycT1 and CRM1 on HIV-1 propagation in rat T cells and macrophages" docx
... with the following primers: 5'-ctggaatcacttggcagct- Page of 12 (page number not for citation purposes) Retrovirology 2009, 6: 43 gagctctacagagagagtcca -3' and 5'tatggtaccttaagcataatcaggaacatcgtatgggtagtcacacatttcttctgggatttc -3' ... (gccaacgctcaatccggttctcgc) and CTGB3 (gctattttccagctgttctcgagtg) were used for the 5' end Primers CTB4 (ttattccctagtccaaggatgac) and CTGB4 (cagacaatagactatcaagacactgtg) were used for the 3' end PCR was performed ... hCycT1 Tg rats were stimulated with anti-rat-CD3 and anti-rat-CD28 Cells were collected at the indicated times and subjected to Western blotting using anti-hCycT1 (C) The expression of hCycT1 and...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo y học: " Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women" potx
... subsequent analyses For the pol gene, we used the primers pro-1 (TTGGAAATGTGGAAAGGAAGGAC) and RT-0 (CATATTGTGAGTCTGTTACTATGTTTAC) with cycles of 50°C 30 minutes, 94°C minutes, and 35 cycles of 94°C ... subject to be monophyletic, and the Templeton test option [29 ,30 ] in PAUP* [27] was used to test the null hypothesis that the polyphyletic tree was not significantly different from the monophyletic ... situation that will not pertain to vaccinated individuals Hence, our results not mean http://www.retrovirology.com/content/6/1/54 that an effective vaccine cannot be developed, but rather they...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: "Association of chemokine receptor gene (CCR2CCR5) haplotypes with acquisition and control of HIV-1 infection in Zambians" pdf
... from the date of their enrollment into the cohort to 1) the date of HIV-1 infection (first seropositive visit) of the initially uninfected exposed partner or 2) the most recent seronegative visit ... Malhotra et al Retrovirology 2011, 8:22 http://www.retrovirology.com/content/8/1/22 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 HLA-B allele-sharing within serodiscordant heterosexual ... did not conform to HWE (Table 2) After stratification of the cohort into transmission and nontransmission index partners, seroconverters, and exposed uninfected partners, the haplotype distribution...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Conformational alterations in the CD4 binding cavity of HIV-1 gp120 influencing gp120-CD4 interactions and fusogenicity of HIV-1 envelopes derived from brain and other tissues" pptx
... Thus, our study provides new insights into structural mechanisms that contribute to altered interactions between gp120 and CD4 These insights contribute to a better understanding of HIV-1 entry ... fusogenicity and the ability of gp120 to interact with CD4 We further show, for the first time, that these alterations appear to increase the exposure of the Gray et al Retrovirology 2011, 8:42 http://www.retrovirology.com/content/8/1/42 ... Operational Infrastructure Support Program received by the Burnet Institute Author details Center for Virology, Burnet Institute, Commercial Rd, Melbourne 30 04, Australia 2Department of Biochemistry...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Human defensins 5 and 6 enhance HIV-1 infectivity through promoting HIV attachment" ppsx
... [35 ] We note that the HD5 and HD6 homodimers display significantly different electrostatic surface potentials from one another, and that HD6 dimerization generates an electropositive cleft not ... enhancement of HIV infection by HD5 was further increased in heparinase-treated target cells by 2-fold compared to that in cells without heparinase treatment In contrast, heparinase treatment did not ... did not exhibit any effect on HIV attachment to target cells (Figure 3B), indicating that the enhancing effect of defensins on HIV attachment required a properly folded structure of defensins To...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot
... 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG -3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG -3' The UBA2 gene fragment was amplified from plasmid pcDNA3.1HHR23A by PCR The ... triplicate and results of these experiments were repeated at least three times Statistic student t- test http://www.retrovirology.com/content/5/1/72 was used to determine potential significant difference ... weight of ubiquitin (polyubiquitin) to Vif was detected by using anti-ubiquitin antibody B-b, the relative intensity of ubiquitin to β-actin control was determined by densitometry Also note that there...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "Selective translational repression of HIV-1 RNA by Sam68DeltaC occurs by altering PABP1 binding to unspliced viral RNA" pps
... (5'-CTCGCCGGACACGCTGAACTTTTTTTTTTTTTTTTTTTT -3' ) with MMLV-RT (Invitrogen) The cDNA generated was then used to generate both spliced and unspliced amplicons using the forward spliced (5'-AGCGGAGACAGCGACGAAGAG -3' ) ... CAG TGA TCT CCT TCT GCA TCC TG -3' , env forward 5'-CAA CAA TGG GTC CGA GAT CTT -3' , env reverse 5'-AGC TCC TAT TCC CAC TGC TC -3' QPCR reactions were run in duplicate for each probe and gradient fraction ... cloned into the EcoRV site of Bluescript Bl-SD-Gag was amplified from HxBruR-/RI- using: 5'-CGCGGATCCGAAGTAGTGTGTGCCCGTCT -3' and 5'-CCCAAGCTTCCCTGCTTGCCCATACTATA -3' The amplicon was digested with BamHI...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "Destabilization of the TAR hairpin leads to extension of the polyA hairpin and inhibition of HIV-1 polyadenylation" pptx
... GGC TTC TC) and the 3' RACE adapter primer (GGC CAC GCG TCG ACT AGT ACT TTT TTT TTT TTT TTT T) that anneals to the polyA tail The cDNA was denatured at 94°C for Page of (page number not for citation ... the HIVrtTA variant that does not need TAR for the activation of transcription, we recently demonstrated that complete deletion of TAR does not abolish in vitro replication, which indicates that ... mutants) In contrast, the double mutant with a truncated TAR hairpin (AB mutant) demonstrated efficient polyadenylation at the 3' end and viruses with this mutation replicated efficiently [34 ]...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... Tris-Cl; pH 7.5, 1% NP-40, 0.05% SDS, 150 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG BA4 (b-actin) GAAGGTGTGGTGCCAGATTT ... sought to investigate the possible interaction between MATR3 and the Rev viral protein To this end, we transfected 29 3T cells with Rev-EGFP, vHY-IRES-TK and Tat Next, we immunoprecipitated endogenous ... attention on a nuclear matrix component Matrin3 (MATR3) that co-purified with HIV-1 RNA Knockdown of MATR3 did not affect HIV-1 transcription, but decreased Gag protein levels pointing to its...
Ngày tải lên: 13/08/2014, 01:21