3 in a test the force p is increased slowly until the fiber is pulled out the pull out force is recorded and the shear strength can be calculated

Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

Ngày tải lên : 27/01/2014, 15:20
... Click Apply, and then click Next A command prompt window will open and close as the profile is created When the Completing the Connection Manager Administration Kit Wizard page appears (as shown in ... Manager profile for dial-up access, and install and test this profile on the client computer DC1 To configure the test lab for dial-up access, create an appropriate user account and an appropriate ... using the EAP-TLS authentication method 10 Use 11 gpupdate to update Group Policy VPN1 To configure the test lab for EAP access, install the appropriate certificate on VPN1, and create an EAP profile...
  • 59
  • 1.1K
  • 0
a study on the impact of cost reduction measures in a chieving the competitive advantages in footwear industry

a study on the impact of cost reduction measures in a chieving the competitive advantages in footwear industry

Ngày tải lên : 13/03/2014, 14:20
... beginning of the year, at the ending of the year, assets and capital companies has increased In particular, most items have increased, but the proportion of asset structure and capital has changed ... and reports for ascertaining and controlling costs” And cost accounting can be determined as the process of measuring, analyzing, computing, and reporting the cost, profitability and performance ... certain period Financial analysis is used as the methods and tools to collect and settle accounting information and other information in the company management to assess the potential and financial...
  • 62
  • 489
  • 0
o'reilly - mcse in a nutshell the windows 2000 exams

o'reilly - mcse in a nutshell the windows 2000 exams

Ngày tải lên : 31/03/2014, 16:59
... settings relating to hardware, the operating system, and applications 3. 2 Installing Windows 2000 Professional Windows 2000's installation process is largely automated and relatively simple and includes ... specific information 3. 2.1.2 Disk partitions Windows NT can be installed in a FAT, FAT32, or NTFS partition The installation program is able to create either of these if there is empty space available ... when the computers are identical in configuration and can only be used for clean (non-upgrade) installations Because a disk image is used, this option can also copy applications installed after the...
  • 420
  • 296
  • 0
learn  windows  powershell  3  in  a  month  of  lunches  2nd  edition

learn windows powershell 3 in a month of lunches 2nd edition

Ngày tải lên : 05/05/2014, 14:44
... sets and common parameters 26 Optional and mandatory parameters 27 Positional parameters 28 Parameter values 30 Finding command examples 32 ■ ■ ■ 3. 6 3. 7 3. 8 Accessing “about” topics 32 Accessing ... But the parameter name is enclosed in square brackets, making it a positional parameter—we could provide the log name without having to type -LogName And because this parameter appears in the ... Starting point 269 Getting PowerShell to the hard work 270 Making parameters mandatory 271 Adding parameter aliases 2 73 Validating parameter input 274 Adding the warm and fuzzies with verbose output...
  • 367
  • 1.3K
  • 0
VMware Infrastructure 3 in a Cisco Network Environment docx

VMware Infrastructure 3 in a Cisco Network Environment docx

Ngày tải lên : 28/06/2014, 19:20
... failed path by the built -in ESX Server multipathing mechanism and switching to another path is called path failover A path fails if any of the components along the path fails, which may include the ... Naming or labeling Port Groups within vSwitches is an important standard to develop and maintain in an ESX environment You could name the Port Group Network Label after the VLAN, or indicate the ... without significant performance degradation All the paths are active at all times (unless a path fails) • In an active/passive disk array, one storage path is actively servicing a given volume The...
  • 90
  • 1.6K
  • 0
báo cáo khoa học: "A case report of male breast cancer in a very young patient: What is changing" docx

báo cáo khoa học: "A case report of male breast cancer in a very young patient: What is changing" docx

Ngày tải lên : 09/08/2014, 01:24
... of the treatment team and included regular physical examinations and history Liver function and alkaline phosphatase tests were not indicated during the time the patient was taking endocrine therapy ... men are dismissed as gynecomastia [9,10] This potential misdiagnosis can result in an unnecessary delay in treatment The median age of breast cancer diagnosis in men is approximately 65 years ... Reports of breast cancer in young male patients are rare Nielsen and Jakobsen described a breast cancer case in a 32 -year-old man [12] More recently, an invasive cancer case was reported in a 30 -year-old...
  • 5
  • 399
  • 0
Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Ngày tải lên : 09/08/2014, 10:20
... operated the patient CD was the treating physician of the patient JG supervised the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... component and increased capillary permeability, causing fluid transudation into the interstitial space and brain oedema Transient Page of Figure Six months after irradiation: superimposed MR images ... The lack of typical clinical symptoms and the limits of anatomical MRI techniques imply that any subacute change suggesting disease progression may be considered as possible PsP Post-RT therapy...
  • 5
  • 425
  • 0
Báo cáo y học: " Mechanical ventilation modulates TLR4 and IRAK-3 in a non-infectious, ventilator-induced lung injury model" pptx

Báo cáo y học: " Mechanical ventilation modulates TLR4 and IRAK-3 in a non-infectious, ventilator-induced lung injury model" pptx

Ngày tải lên : 12/08/2014, 11:20
... Tachykinins and tachykinin receptors in human uterus Br J Pharmacol 20 03, 139 :5 23- 532 Nakayama K, Okugawa S, Yanagimoto S, Kitazawa T, Tsukada K, Kawada M, Kimura S, Hirai K, Takagaki Y, Ota ... Statistical analysis was performed with the Fisher exact test and paired and unpaired Student t-tests, as appropriate Comparisons that involved all groups of animals were performed with one-way ... regulator of the TLR pathways and a master regulator of NF-B and inflammation [ 13, 14] Several known pathways can lead to NF-B activation The classical (canonical) pathway involves the activation...
  • 11
  • 371
  • 0
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

Ngày tải lên : 13/08/2014, 01:20
... ******************************************************************** Contaminant PmERV Chr 69:CCTCATCAGGTCTTCAATGTTACTTGGAGAGTTACCAACTTAATGACAGGACAAACAGCTAATGCTAC 136 69:CCTCATCAGGTCTTCAATGTTACTTGGAGAGTTACCAACTTAATGACAGGACAAACAGCTAATGCTAC 136 ******************************************************************** ... 642:CCTGATAGCGGCGGACCCCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACAGAGCACAACCCTCCTCCTCTGCCAGGGAGAACGACGAAGAAGAGGCGGC 6 43: CCTGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC ... ******************************************************************** p- env3f Contaminant 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAAAAAAAGGGCAAGAACATTTGAC 272 PmERV Chr 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAGAAAAAGGGCAAGAACATTTGAC 272...
  • 7
  • 349
  • 0
Báo cáo y học: "A rare cause of specific cough in a child: the importance of following-up children with chronic cough" ppt

Báo cáo y học: "A rare cause of specific cough in a child: the importance of following-up children with chronic cough" ppt

Ngày tải lên : 13/08/2014, 08:20
... 53 paediatric reports) [6-8] and represent approximately 10% of paediatric pulmonary tumours [7] Macroscopically, MEC appear as a polypoid mass extending into the lumen [6-9] which may appear ... and abdomen CT scans revealed no metastases Bronchoscopy was repeated and the remaining small lesions were biopsied Right upper lobectomy and lymph node sampling was then performed and histological ... interstitial markings of the right lower lobe were commenced and later ceased when cultures and Quantiferon test were negative Histology showed a subepithelial neoplasm comprising glandular and solid areas...
  • 5
  • 276
  • 0
Step by step guide demonstrate DHCP NAP enforcement in a test lab

Step by step guide demonstrate DHCP NAP enforcement in a test lab

Ngày tải lên : 26/12/2014, 09:14
... is initially displayed as off, and then displayed as on Although Windows Firewall is turned on, CLIENT1 cannot install an antivirus application automatically, so it will remain in a noncompliant ... deploy a NAP DHCP enforcement test lab so that you can better understand how DHCP enforcement works In this guide This paper contains an introduction to NAP and instructions for setting up a test ... as a DHCP client and a NAP client You must be logged on as a member of the Domain Admins group or a member of the Administrators group on each computer to complete the tasks described in this...
  • 29
  • 646
  • 0
3 chất béo không thể thiếu cho não bé ppt

3 chất béo không thể thiếu cho não bé ppt

Ngày tải lên : 01/08/2014, 13:20
... trong hai năm đầu đời lúc não phát triển nhanh Hãy cung c p đủ cho nguồn chất béo sau đây: S a mẹ s a bột Trong tháng đầu đời, nhận tất chất béo thể cần từ s a mẹ S a mẹ có ch a chất ... thủy ngân cao cá kiếm, cá cờ… Cung c p cho loại cá ch a thủy ngân th p, cá hồi, hai lần tuần Hãy chắn cá không xương nghiền xay nhuyễn Chat beo cho nao tre - Thịt nguồn chất béo bão h a, có hại ... thông qua chế độ ăn uống thân Ngoài s a mẹ, s a công thức bổ sung chất béo thiết yếu Khi bắt đầu ăn thức ăn rắn, ti p tục nhận lượng chất béo quan trọng từ s a mẹ s a bột năm 2 Các sản phẩm...
  • 5
  • 241
  • 0
Báo cáo y học: "In critically ill patients the procalcitonin level can be misleading" pdf

Báo cáo y học: "In critically ill patients the procalcitonin level can be misleading" pdf

Ngày tải lên : 14/08/2014, 08:21
... Sepsis Campaign guidelines for severe sepsis or septic shock Fortunately, the Surviving Sepsis Campaign bundle is clear on this point and these patients received appropriate antibiotics in accordance ... controlled trial Lancet 2010, 37 5:4 63- 474 Kopterides P, Siempos II, Tsangaris I, Tsantes A, Apmaganidis A: Procalcitoninguided algorithms of antibiotic therapy in the intensive care unit: a systematic ... this guideline Abbreviations ICU, intensive care unit; PCT, procalcitonin Competing interests The authors declare that they have no competing interests Author details Department of Critical Care,...
  • 2
  • 189
  • 0
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

Ngày tải lên : 25/10/2012, 10:39
... participated in the collection and interpretation of the data and were involved in drafting the manuscript MG participated in analysis and interpretation of the data and in drafting the manuscript PS, ... study and was involved in the interpretation of the data and manuscript revision All authors read and approved the final manuscript Acknowledgements All residents, clinical fellows and intensivists ... clinically relevant and irrelevant findings, and simply reported on all abnormalities [12] At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands...
  • 7
  • 722
  • 0
Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc

Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc

Ngày tải lên : 14/02/2014, 17:20
... boundaries are graphical away from the boundary Here small means contained in a small ball 527 PLANAR DOMAINS A “pair of pants” (in bold) Graphical annuli (dotted) separate the “pairs of pants” ... curvature is large at some point (and hence the surface is not a graph), then it is a double spiral staircase To prove that such a disk is a double spiral staircase, we will first prove that it can be ... 2: The catenoid given by revolving x1 = cosh x3 around the x3 -axis Necks connecting parallel planes Figure 3: The Riemann examples: Parallel planes connected by necks axis and the separation between...
  • 51
  • 463
  • 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Ngày tải lên : 21/02/2014, 01:21
... of the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0 .3% L-arabinose and is predominantly linear Potato arabinogalactan ... Using potato and onion arabinogalactan as substrate, a small increase in all four products is observed during the incubation The product formation using soy arabinogalactan as a substrate is ... then cloning a fragment, starting at this NsiI site and containing the galA gene and approximately 700 bp 3 -flanking region, in pIM4700 (containing the pkiA promoter) A niger The sugar composition...
  • 9
  • 669
  • 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Ngày tải lên : 08/03/2014, 08:20
... values for the cAMP pathway and for the inositol phosphates pathway SP, [Ala9]SP and [Pro9]SP are almost equipotent at the major binding site NK-1M (Ki between 0.64 nM and 1.6 nM and EC50 values ... of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried out at 22 °C with either [3H][Pro9]SP (0.2–0.5 ... biological activities between [Ala9]SP and [Gly9]SP on the one hand, and [b2-HAla9]SP and [HGly9]SP on the other hand Indeed, the higher pharmacological potency of [b2-HAla9]SP compared to [HGly9]SP...
  • 11
  • 860
  • 0

Xem thêm