3 apos and 5 apos of broadly expressed genes
Comparison of calculation result of 3 bus and 5 bus equivalent system
... Dốc Sỏi 50 45 43.19 41.83 39.49 40 MOV(MJ) 35 30 25 20.39 20 15 10 3.96 3.09 Tụ 43 Ohm Quảng Trạch Tụ 43 Ohm Dốc Sỏi Hệ thống nút Tụ 30.5 Ohm Dốc Sỏi Hệ thống nút 25 Calculation Result 4.3 Comparison ... system 30.5 Ohm Doc Soi Capacitor Bus system 23 Calculation Result 4.3 Comparison of MOV calculation result phase short-circuit at Quảng Trạch 140 132.18 126.55 120 MOV(MJ) 100 80 60 40 23.03 14.19 ... Comparison of MOV calculation result phase short-circuit at Pleiku 70 58.29 60 MOV(MJ) 50 40 30 26.75 23.76 20.17 20 10 0 43 Ohm Quang Trach Capacitor 43 Ohm Doc Soi Capacitor Bus system 30.5 Ohm...
Ngày tải lên: 10/10/2022, 12:52
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... F258Y E292Q:L5 F229A ⁄ E292S:L3 32.65–1.90 (1.95–1.90) P212121 a = 60.33 b = 65.39 c = 96.49 a = b = c = 90° 0.052 (0.21) 13.8 (3.3) 98.9 (95.3) 3.3 (2.6) 30 432 0.135 0.168 0.014 1.35 0.09 3211 ... 3211 38.23–2.00 (2.11–2.00) P212121 a = 58.57 b = 64.63 c = 94.48 a = b = c = 90° 0.069 (0.43) 17.4 (3.7) 100.0 (100.0) 5.4 (5.3) 25 035 0.154 0.200 0.020 1.46 0.11 3233 334 21 24 308 21 22 19.85–1.80 ... 19.85–1.80 (1.85–1.80) P212121 a = 59.95 b = 65.32 c = 96.54 a = b = c = 90° 0.039 (0.16) 14.2 (4.7) 99.3 (94.1) 3.2 (2.4) 35 563 0.136 0.163 0.012 1.25 0.08 3214 24 289 17 19 24 75 38.19–1.70 (1.79–1.70)...
Ngày tải lên: 15/03/2014, 23:20
3 axis and 5 axis machining with stewart platform
... 1451561 1452290 326326 464987 326326 49336 326326 49336 1438353 1437327 1478117 1452290 326326 464987 326326 49336 326326 49336 1438353 1437327 S3 1463124 1452290 326326 464987 326326 49336 326326 ... 326326 49336 326326 49336 1438353 1436571 S4 1527877 1452290 326326 464987 326326 49336 326326 49336 1438353 1441181 S5 1532208 1452290 326326 464987 326326 49336 326326 49336 1438353 1441181 S6 ... 1440899 1452290 495722 466228 326326 49336 326326 49336 1438353 1436571 Time Interval(S) 1993 36 19 2364 13 17 11 14 36 Table E2 The time calculation when the velocity is 50000 step/sec and the...
Ngày tải lên: 09/09/2015, 10:17
Lecture AP Biology Chapter 3 Water and the fitness of the environment
... each Chapter Water and the Fitness of the Environment You Must Know • • • • The importance of hydrogen bonding to the properties of water Four unique properties of water, and how each contributes ... What property of water allows a water strider to “walk” on water? Contrast adhesion and cohesion Give an example of each Contrast hydrophobic and hydrophilic substances Give an example of each Chapter ... measure of how difficult it is to break or stretch surface of liquid Properties of H2O B Adhesion = bonding between unlike molecules Adhesion of H2O to vessel walls counters ↓ pull of gravity...
Ngày tải lên: 18/05/2017, 08:58
Identification and comparative analysis of differentially expressed miRNAs in leaves of two wheat (Triticum aestivum L.) genotypes during dehydration stress
... 50142(21.97%) 55613(21.93%) 54114(21.33%) 70463(23.19%) 554968(7.56%) 449981(7.63%) 673621(9.19%) 544438(8.74%) Total 228251(100%) 253538(100%) 253662(100%) 303835(100%) 7336523(100%) 5897423(100%) 7325857(100%) ... 20653733(100%) 12005904(58.13%) 650391(3.15%) T1 19546412(100%) 10544528(53.95%) 1046638(5.35%) C2 19375732(100%) 10619535(54.81%) 846328(4.37%) T2 21290140(100%) 11701889(54.96%) 1798773(8.45%) ... 112291(49.20%) 126346(49.83%) 133724(52.72%) 147784(48.64%) 1995335(27.20%) 2054201(34.83%) 2095372(28.60%) 2517033(40.42%) tRNA 37394(16.38%) 37971(14.98%) 35593(14.03%) 45462(14.96%) 3764841(51.32%) 2166029(36.73%)...
Ngày tải lên: 26/05/2020, 23:39
Transcriptomic analysis of differentially expressed genes in an orange-pericarp mutant and wild type in pummelo (Citrus grandis)
... 14403818 14223118 1.42G 0.03 97.27 91.76 43.44 MT3 14197855 14025066 1.4G 0.03 97.31 91.87 43.53 WT1 13520581 13347784 1.33G 0.03 97.23 91.68 43.6 WT2 14715034 14532229 1.45G 0.03 97.29 91.82 43.49 ... (76.37%) 11324323 (75.36%) Non-splice reads 8768392 (54.51%) 7846392 (55.17%) 7591808 (54.13%) 7219051 (54.08%) 7991617 (54.99%) 8176531 (54.41%) Splice reads 3451723 (21.46%) 3036838 (21.35%) 3127816 ... 492073 (3.06%) 437971 (3.08%) 477365 (3.4%) 466493 (3.49%) 455224 (3.13%) 532109 (3.54%) Uniquely mapped 12220115 (75.97%) 10883230 (76.52%) 10719624 (76.43%) 10127254 (75.87%) 11098780 (76.37%)...
Ngày tải lên: 26/05/2020, 23:48
de novo transcriptome assembly for rudimentary leaves in litchi chinesis sonn and identification of differentially expressed genes in response to reactive oxygen species
... 45% 0.01% 46.11% Lc5h-2 32,276,093 1,581,528,557 98.48% 0.01% 46.28% Lc10h-1 30,733,719 1,505,952,231 98.50% 0.01% 45.90% Lc10h-2 31,382,314 1,537,733,386 98.51% 0.01% 45.83% One reference library ... of 14 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 induction of Cell-Wall degrading genes coupled to a stimulation of endo and exocytosis PLoS One 2013, 8:e58363 Li C, Wang Y, Huang ... library 61,338,190 6,133,819,000 97.82% 0.01% 46.73% Lc0h-1 Lc0h-2 30,382,747 1,488,754,603 98.51% 0.01% 46.11% 30,181,112 1,478,874,488 98.53% 0.01% 45.85% Lc5h-1 28,942,560 1,418,185,440 98 45% 0.01%...
Ngày tải lên: 02/11/2022, 09:22
Whole-transcriptome analysis of differentially expressed genes in the mutant and normal capitula of Chrysanthemum morifolium
... (KOG), and Kyoto Encyclopedia of Genes and Genomes (KEGG)], leaving 11,508 (8.85%) unannotated unigenes A total of 118,043, 101,048, 87,630, and 54,245 unigenes were annotated on the basis of searches ... metabolism 1511 4.86% ko00500 RNA transport 1350 4.35% ko03013 Plant hormone signal transduction 1339 4.31% ko04075 Ubiquitin mediated proteolysis 1205 3.88% ko04120 Plant-pathogen interaction 1202 3.87% ... 1085 3.49% ko03015 Purine metabolism 1080 3.48% ko00230 RNA degradation 1045 3.36% ko03018 Ribosome 1016 3.27% ko03010 Oxidative phosphorylation 1013 3.26% ko00190 Aminoacyl-tRNA biosynthesis 933...
Ngày tải lên: 30/01/2023, 20:10
Transcriptomics analysis of differentially expressed genes in subcutaneous and perirenal adipose tissue of sheep as affected by their pre and early postnatal malnutrition histories
... 0.04703 C1QA 7.427 TYROBP LAPTM5 LAPTM5 0.04703 LAPTM5 7.275 LAPTM5 PTPN6 FN1 0.04703 PTPN6 5.573 C5AR1 C5AR1 C1QB 0.04703 C5AR1 5.306 PTPN6 Ahmad et al BMC Genomics (2021) 22:338 Page of 21 ... ENSOARG00000010203 35.73 RSL24D1 10 NMD3 10 GTF2B 0.014873 RSL24D1 34.388 ENSOARG00000008494 PRKACB 10 CDKN2AIPNL 0.013221 ENSOARG00000019688 34.338 SRP54 SRP54 10 ENSOARG00000010203 0.013221 SRP54 34.311 ... LAPTM5 0.038743 C1QB 13.461 CTSS 10 CTSS 11 CTSS 0.038743 TYROBP 13.449 C1QB 10 C1QB 10 CSF1R 0.038743 CTSS 13.19 CSF1R CSF1R C1QC 0.038743 CSF1R 13.163 TYROBP SPI1 C1QB 0.038743 C1QA 12.963 SPI1...
Ngày tải lên: 23/02/2023, 18:22
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... peroxidase 10 Cathepsin L Cystatin B 0 5 0 5 10 0 5 10 15 0 5 0371417 24 0 5 03714 17 24 0 5 037141724 * * * * * * * * * * * Translation initiation factor eIF-2B 0 5 10 0 5 037141724 * * * * A B Fig. 2. ... pooled gills and mantle of C. gigas. Genes were clustered into 15 categories according to their putative biological function. A1 and A2, 25 and 13 °C at 7–10 days; B1 and B2, 25 and 13 °C at 24 ... Rholp 0 5 037141724 0 5 037141724 * * * * * * Chaperonin containing TCP1, sub. 7 0 0 5 037141724 5 10 * * * * * * * * * * 0 5 10 0 5 10 Glutamine synthetase D-lactate dehydrogenase 0 5 037141724 0 5 037141724 0 5 037141724 0 5 10 9...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... accession numbers AY158634, AY158635, AY158636, AY158637, AY158638, AY158639, AF548351, AY152843, AY159807, AY159808, AY159809, AY159810, AY159811, AY243574, AY243575, AY243576, AY243577. (Received ... (vp0016B10VAZ and vp0016C06VAZ, DDBJ/EMBL/GenBank accession no.s AY243574 and AY243577, respectively) and V. a. aspis (vp0015F11VAN and vp0015C10VAN, DDBJ/EMBL/GenBank accesion no.s AY243575 and AY243576, ... (Table 3). Exons 3, 4 and the 5¢ part of exon 5 encode the mature protein; exon 1 encodes the 5¢-UTR, and exon 2 and part of exon 3 encode the signal peptide. The 110 nucleotides at the 3¢ end of...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure doc
... 4e-37 Unknown genes (27 sequences)a GenBank accession no CB617403 CF369139 CF369128 CF369136 CF369137 CF369140 CF369125 CF369127 CF369143 AF177226 AF177226 CF369132 CF369142 CF369126 CF369134 ... AF177226 CF369132 CF369142 CF369126 CF369134 CF369147 CF369131 CF369135 CF369141 CF369133 CF369129 CF369145 CF369146 CF369144 CF369138 CF369148 to CF369174 a Sequences with nonsignificant e-value ... CB617403 AF177226 AF177226 AF177226 CF369132 CF369126 CF369221 CF369226 CF369227 CF369228 CF369225 CF369141 CF369133 CF369223 CF369224 CF369222 CF369229 to CF369244 a Sequences with nonsignificant...
Ngày tải lên: 30/03/2014, 15:20
báo cáo khoa học: " Identification of differentially expressed genes induced by Bamboo mosaic virus infection in Nicotiana benthamiana by cDNA-amplified fragment length polymorphism" pps
... (5’GAACAAAAAAATGGAGTTTTA3’), (5’CGAACTCCCAACTGGCTTTC3’), (5’CTCTGGAAAGGAGAGCAATGTC3’), and (5’GAAC GCTTTGATGAGAATAGAGA3’) and the reverse primers (5’GTCATTGCTCCTAATAAGGT3’), (5’CTCC TCCAGAAGCAAATAGTTTC3’), (5’CGAACAAATT ... reaction containing 2.5 μl of 30fold diluted cDNA template, 100 pmole each of TaqI primer (5’GTAGACTGCGTAC3’) and MseI primer (5’GATGAGTCCTGAG3’), 0.25 mM dNTP, 1.5 mM MgCl2, and units of Taq DNA polymerase ... 9e-08 ACGT2-1 CAA41713.1 193 - photosystem II 23 kDa polypeptide [Nicotiana tabacum] 5/6 3e-20 ACGT3-1 AAA34053.1 190 + beta-1,3-glucanase [Nicotiana tabacum] 5/6 2e-15 ACGT8-1 CAJ32461.1 160 + putative...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "Genome-wide expression profiling and bioinformatics analysis of diurnally regulated genes in the mouse prefrontal cortex" pps
... http://genomebiology.com/2007/8/11/R247 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 Genome Biology 2007, Coates G, Cuff J, Curwen V, Cutts T, et al.: An overview of Ensembl Genome Res 2004, 14:925-928 GNF ... 1.473 HSF M00736 1.3 0.002 E2F-1:DP-1 M00634 1.355 GCM M00083 1.284 0.002 MZF1 M01036 1.223 0.004 COUPTF M00069 1.265 0.005 YY1 M00119 Lentiviral_TATA M00731 Myogenin 0.003 M00658 0.001 1.505 M00261 ... 1.579 0.003 HNF1 M00411 1.383 HNF-4alpha1 M00712 1.294 0.004 Olf-1 1.392 0.005 PU.1 M01066 1.577 BLIMP1 1.915 0.001 Osf2 M00655 1.3 0.003 PEA3 M00116 1.711 0.005 C/EBPalpha M00123 1.39 0.005...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Improving identification of differentially expressed genes in microarray studies using information from public databases" pptx
... 5v5 regularized t-test. Number of genes Number of true 'top 50' genes present 5v5 Regularized t-test 3v3 GEO/R.t-test vote 3v3 GEO 3v3 Regularized t-test 0 50 100 150 200 250 300 350 ... returned by a 5v5 sample t-test. Number of genes Number of true 'top 50' genes present 2v2 GEO 5v5 t-test 4v4 t-test 3v3 t-test 2v2 t-test 0 50 100 150 200 250 300 0 5 10 15 20 http://genomebiology.com/2004/5/9/R70 ... probe 39638_at Standard deviation of probe 38998_g_at Number of chips Number of chips Number of chips Standard deviation of probe 922_at 3,000 3,500 4,000 4,500 5,000 2,000 3,000 4,000 0 100 200 300...
Ngày tải lên: 14/08/2014, 14:21
Heterologous expression and transcript analysis of gibberellin biosynthetic genes of grasses reveals novel functionality in the GA3ox family
... Bradi2g57030 Partiala (3A) FLa(3B) FLa (3D) GA20ox3 Os07g07420 Bradi1g56200 Partial (3A) FL (3B) FLa (3D) GA20ox4 Os05g34854 Bradi2g24980 FLa (1AL) FLa,b (1BL) FLa,b (1DL) GA3ox1 Os05g08540 - ... (7D) GA2ox3 Os01g55240 Bradi2g50280 Partial (3AL) FL (3B) FLa (3D) GA2ox4 Os05g43880 Bradi2g19900 FLa (1AL) FLa (1B) FLa (5BL) GA2ox5 Os07g01340 Bradi1g59570 - - - GA2ox6 Os04g44150 Bradi5g16040 ... (2015) 15:130 Page of 18 GA131 GA4 O H O O H O HO HO H H HO O HO GA 3-oxidase TaGA3ox2 TaGA3ox-B3 HvGA3ox2 BdGA3ox2a,b HO O GA 3,18-oxidase HvGA3,18ox1 O H 11 19 O 10 12 13 14 GA9 H 18 HO 15 16...
Ngày tải lên: 26/05/2020, 21:17
Triterpenoid profiling and functional characterization of the initial genes involved in isoprenoid biosynthesis in neem (Azadirachta indica)
... Pandreka et al BMC Plant Biology (2015) 15:214 DOI 10.1186/s12870-015-0593-3 RESEARCH ARTICLE Open Access Triterpenoid profiling and functional characterization of the initial genes involved ... pericarp of stages 1, and (~48-66 mg/g) Pericarps of stages 4, and kernel of stage were found to possess comparatively lower amount of triterpenoids in the range of ~2535 mg/g Flowers and leaves ... 22 and 45 mg/g of triterpenoids (including chlorophyll and other pigments), while stem and bark furnished 15 and 10 mg/g of the tissue respectively Standard graphs were prepared for each of the...
Ngày tải lên: 26/05/2020, 22:00
Genome-wide investigation and expression analysis suggest diverse roles and genetic redundancy of Pht1 family genes in response to Pi deficiency in tomato
... 80.7 82.5 81.1 LePT2 71.0 - 77.2 60.5 60.1 100.0 73.9 73.1 LePT3 76.1 70.4 - 60.5 61.5 77.2 77.0 76.0 LePT4 61.2 59.3 59.2 - 89.8 60.5 59.3 58.0 LePT5 60.9 57.6 59.4 86.0 - 60.1 59.3 58.7 LePT6 ... The characterization of novel Chen et al BMC Plant Biology 2014, 14:61 http://www.biomedcentral.com/1471-2229/14/61 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 mycorrhiza-specific ... 59.3 58.7 LePT6 71.0 100.0 70.4 59.3 57.6 - 73.9 73.1 LePT7 74.6 67.1 70.5 59.0 59.9 67.1 - 92.5 LePT8 75.2 67.0 69.5 58.1 59.0 67.0 91.4 - identical to that of the known LePT2, but with much...
Ngày tải lên: 27/05/2020, 00:52
Báo cáo y học: " Functions, structure, and read-through alternative splicing of feline APOBEC3 genes" ppt
... downstream of exon for all three A3C genes - A3Ca (positions 32 ,50 5, 33 ,37 6 and 33 ,444), A3Cb (positions 42,0 83, 42, 954 and 43, 022), and A3Cc (positions 22,960 and 23, 831 ) - and A3H (position 50 ,31 9) ... (EU01 636 2); lion A3C#1 (EU00 75 43) ; lion A3C#2 (EU00 754 4); lynx A3C#1 (EU00 754 6); lynx A3C#2 (EU01 636 3); lynx A3C #5 (EU00 754 7); lynx A3C#6 (EU00 754 8); puma A3C (EU00 754 5); leopard A3H (EU00 755 1); ... feline A3 promoters and that of human A3G [31 ], including two ETS-SP1 (A3Ca, A3Cb, A3Cc and A3H), IKRS-AP2 (A3H), and NFκB paired with either CEBP (A3Ca and A3Cb), RBPF (A3Ca, A3Cb and A3Cc) or...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx
... C4 C5 C6 P1 P2 P3 P4 P5 P6 P7 438 88 438 89 438 92 438 94 29 (4-FS) 40 ( 139 8) 41 (9 73) 42 ( 75) 43 (796) 44 (1489) 30 09-88 (3D) 30 77-88 (3E) 31 04-88 (3C) 32 99- 85 (3A) C7-88 (4E) C681-87 (4D) C999-87 ... O 157 -C-1-2), and 14 USA isolates; strains of ATCC (A1, A2, A3, and A4), strains of Cornell University (C1, C2, C3, C4, C5, and C6), and strains of Pennsylvania State University (P3, P4, P5, and P7) ... coli O 157 :H7 Rapid kit 99 .58 (1,6 75/ 1,682)b 99.41 (1,672/1,682) 99 . 35 (1,671/1,682) 0.42 (7/1,682) 0 .59 (10/1,682) 0. 65 (11/1,682) a No of positive/No of samples examined No of negative/No of samples...
Ngày tải lên: 07/08/2014, 18:21