biztalk 2010 recipes
... Using the Looping Functoid 133 3 13 Using the Iteration Functoid 137 3 14 Creating a Custom Functoid 141 3 15 Using the Date and Time Functoids 1 45 3 16 Creating ... Messages 270 5 10 Using the Parallel Action Shape 272 5 11 Using the Loop Shape 2 73 5 12 Using the Transform Shape 2 75 5– 13 Using the Call Orchestration ... 53 2 11 3 Using the BAM Portal 54 0 11–4 Setting Up BAM Alerts 54 6 11 5 Using the BAM Interceptor 55 1 11–6 Creating a BAM Service Request 55 5 11–7...
Ngày tải lên: 05/05/2014, 13:17
... 20 05, 33 0: 1 35 7 39 Moreno LA, Rodriguez G: Dietary risk factors for development of childhood obesity Curr Opin Clin Nutr Metab Care 2007, 10 :33 6 -34 1 40 Leahy KE, Birch LL, Rolls BJ: Reducing the ... activity, and television viewing in children during the adiposity rebound period: the Iowa Bone Development Study Preventive Medicine 2002, 35 :5 63- 57 1 33 Moore LL, Gao D, Bradlee ML, Cupples LA, Sundarajan-Ramamurti ... integrating the establishment of working groups at the community and the school level This bottom-up approach increases the likelihood of program sustainability in the long term [55 ] Furthermore, the...
Ngày tải lên: 14/08/2014, 08:20
... interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 5. 1 .3 Copyright 20 03, Cisco ... by typing exit Turn the router off 3- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 5. 1 .3 Copyright 20 03, Cisco Systems, Inc Erasing and reloading the router Enter into the privileged EXEC ... Enter The router is ready for the assigned lab to be performed 4 -5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 5. 1 .3 Copyright 20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet...
Ngày tải lên: 18/01/2014, 04:20
Tài liệu Lab 5.1.3 Using the Boot System Command doc
... interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 5. 1 .3 Copyright 20 03, Cisco ... by typing exit Turn the router off 3- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 5. 1 .3 Copyright 20 03, Cisco Systems, Inc Erasing and reloading the router Enter into the privileged exec ... Enter The router is ready for the assigned lab to be performed 4 -5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 5. 1 .3 Copyright 20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet...
Ngày tải lên: 18/01/2014, 04:20
Báo cáo toán học: " Completion of the Wilf-Classification of 3-5 Pairs Using Generating Trees" pps
... sn ( 132 , 5 234 1) = sn ( 132 , 53 2 41); sn ( 132 , 34 2 15) = sn ( 132 , 4 231 5) ; sn ( 132 , 32 1 45) = sn ( 132 , 432 51 ); sn ( 132 , 45 231 ) = sn ( 132 , 4 53 1 2); and sn ( 132 , 4 53 2 1) = sn ( 132 , 53 4 21) It is easy to verify ... that the only other possible Wilf-equivalences among 3- 5 pairs are sn (1 23, 15 432 ) = sn (1 23, 2 15 43) = sn (1 23, 32 51 4) = sn (1 23, 32 54 1) = sn (1 23, 432 51 ) and sn (1 23, 4 25 13) = sn ( 132 , 34 2 15) The ... lead to the following nontrivial Wilf-equivalences: sn ( 132 , 1 234 5) = sn ( 132 , 2 134 5) = sn ( 132 , 231 45) = sn ( 132 , 234 15) = sn ( 132 , 234 51 ) = sn ( 132 , 32 4 15) = sn ( 132 , 32 451 ) = sn ( 132 , 34 1 25) =...
Ngày tải lên: 07/08/2014, 13:21
Nghiên cứu sự ảnh hưởng của một số tham số lượng tử đến tính axit của dãy Benzoic thế - Chương 3-5
... 150 44.940 15 034 .2 73 15 036 . 155 150 41.8 03 150 43. 6 85 150 45. 568 150 66.9 03 15 033 .018 - 35 6.676 - 35 5. 847 - 35 4.267 -31 4.178 -36 5. 036 -34 6 .52 8 - 35 8.2 75 -36 1 . 35 6 -36 7.019 - 35 5. 150 - 35 4.801 - 35 6. 850 - 35 8 .36 3 ... -33 8021 .52 8 -36 2740. 0 35 -36 2682.447 -409047.696 -31 1260 .34 3 -33 59 22 .58 5 -36 059 5. 958 -38 52 64.298 -409 932 .32 5 - 456 241. 431 -38 238 6.098 150 19.2 13 150 24. 233 150 24.860 150 11.6 83 150 29.880 150 29.2 53 ... - 35 8 .36 3 -34 8.714 1 .54 7 1 .55 5 1. 53 5 1.714 1 .50 2 2.669 1 .58 6 3. 357 1.989 1. 8 35 1.769 1. 836 2.498 2.707 -0. 255 -0. 251 -0. 250 -0.4 45 -0. 255 -0.447 -0.212 -0 .33 2 -0.286 -0.296 -0 .33 9 -0 .33 7 -0 . 35 7...
Ngày tải lên: 09/11/2012, 15:03
thể dục lơp 3-5 (tuần 1)
... lại…….đứng ĐỊNH LƯỢNG 6p Đội Hình * * * * * * * * * * * * * * * * * * * * * * * * GV 50 p 7p Đội hình học tập 25p * Chào,báo cáo GV nhận lớp kết thúc học: GV hướng dẫn, học sinh thực Nhận xét *Cán ... 10 p * * * * * * * * * II/ CƠ BẢN: 50 p GV a Giới thiệu chương trình TD lớp Biên chế 7p tổ chức tập luyện, chọn cán mơn b Phổ biến nội quy học tập c ơn ĐHĐN 25p Đội hình học tập Tập hợp hàng dọc, ... * * * * * * * II/ CƠ BẢN: 50 p GV a Giới thiệu chương trình TD lớp Biên chế 7p Đội hình học tập tổ chức tập luyện, chọn cán mơn b Phổ biến nội quy học tập c ơn ĐHĐN 25p Tập hợp hàng dọc, dóng...
Ngày tải lên: 17/09/2013, 19:10
AJAX-Style Mapping Using the Virtual Earth SDK
... asynchronous requests for the map tiles using XMLHttpRequest You can see the request, issued by the map control: #11 10 :34 :28. 656 65. 55. 241 .30 :80 GET /tiles/r021 230 000.png?g= 15 HTTP/1.1 Accept: */* ... CHAPTER ■ AJAX-STYLE MAPPING USING THE VIRTUAL EARTH SDK This is the response from the VE map server: #12 10 :34 :28. 859 65. 55. 241 .30 :80 HTTP/1.1 200 OK Content-Length: 17 055 Content-Type: image/png ... specify the direction For X, negative values pan to the left of the map, and positive values pan to the right For Y, negative values pan toward the bottom of the map, and positive ones pan to the...
Ngày tải lên: 05/10/2013, 10:20
Bài soạn giáo án thể dục lớp 3+5 tuần 16 - 20 ckt
... ngày 30 tháng 11 năm 2010 Tiết: 3+ 4 TD 3D,3C Bài 33 : Ôn tập rèn luyện t Trò chơi: Chim tổ " I/Mục tiêu: - Tập hợp hàng ngang, dóng hàng.Biết cách tập hợp hàng ngang, dóng thẳng hàng ngang - Đi theo ... nhận xét đánh giá giao tập nhà ĐHTC: GV x x x x x 4 -5 phút - ĐHKT: GV x x x x x x x x x x x x x x x x x x 75 Tiết 2 +3 TD 3C,3D Tiết 38 Bài 38 : ôn đội hình đội ngũ trò chơi thỏ nhảy I Mục tiêu: ... Cỏn s iu khin lp ụn - GV theo dừi sa sai - ễn c lp - Chia t luyn - Kim tra - t Nhn xột ĐHKT x x x x x x x x x x x x x x x x x x x x x GV Tit 2 +3 TD 3C,3D Tiết 32 BI 32 :Ôn tập rèn luyện t Đội...
Ngày tải lên: 24/11/2013, 19:11
Tài liệu Build Your Own ASP.NET 3.5 Web Site Using C# & VB, 3rd Edition docx
... 33 3 Updating Existing Data 33 4 The INSERT Statement 33 4 The UPDATE Statement 33 5 The ... 1 53 Using the Validation Controls 2 23 Database Design and Development 259 Speaking SQL 30 3 ADO.NET 34 3 10 Displaying Content Using Data Lists 4 13 11 Managing ... 32 9 The COUNT Function 33 0 Grouping Records Using GROUP BY 33 0 Filtering Groups Using HAVING 33 2 The SUM,...
Ngày tải lên: 14/02/2014, 10:20
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... noncomplementary tails at the 5 end (Fig 5B), the 3 end (Fig 5C), both the 5 and 3 ends (Fig 5D) or at neither end (Fig 5A) The results showed that there was no significant difference in the DNA unwinding ... autoradiogram in Figs 5I and J The results show that PDH120 moves unidirectionally in the 3 5 direction (Fig 5I, lanes and 3) and not in the 5 3 direction (Fig 5J, lanes and 3) The 5 3 directional ... (UÆmg)1) 201 12.6 4.72 0.2 83 0.0 53 0.006 ND ND ND 29 33 3 24 800 11 39 0 1 03 650 467 924 898 33 3 SDS/PAGE followed by silver staining revealed the presence of two polypeptides of 54 and 66 kDa in fraction...
Ngày tải lên: 20/02/2014, 11:20
Build Your Own ASP.NET 3.5 Web Site Using C# and VB docx
... 33 3 Updating Existing Data 33 4 The INSERT Statement 33 4 The UPDATE Statement 33 5 The ... 1 53 Using the Validation Controls 2 23 Database Design and Development 259 Speaking SQL 30 3 ADO.NET 34 3 10 Displaying Content Using Data Lists 4 13 11 Managing ... 32 9 The COUNT Function 33 0 Grouping Records Using GROUP BY 33 0 Filtering Groups Using HAVING 33 2 The SUM,...
Ngày tải lên: 08/03/2014, 20:20
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx
... phosphatidylinositol 3, 4-bisphosphate [PtdIns (3, 4)P2], PtdIns (3, 5) P2, PtdIns(4 ,5) P2 and phosphatidylinositol 3, 4 ,5- triphosphate [PtdIns (3, 4 ,5) P3], and weakly with PtdIns (3) P, PtdIns(4)P and PtdIns (5) P The protein ... PtdIns (3, 5) P2 and PtdIns (3, 4 ,5) P3, and bound even at 3. 1 pmol on the sheet The affinity for PtdIns (3, 4)P2 and PtdIns(4 ,5) P2 was relatively low We examined the binding selectivity of PCaP1 using ... 3, 4-bisphosphate; PtdIns (3, 5) P2, phosphatidylinositol 3, 5- bisphosphate; PtdIns(4 ,5) P2, phosphatidylinositol 4 ,5- bisphosphate; PtdIns (3, 4 ,5) P3, phosphatidylinositol 3, 4 ,5- triphosphate, PE, phosphatidylethanolamine;...
Ngày tải lên: 23/03/2014, 07:20
CEEH Scientific Report No 3: Assessment of HealthCost Externalities of Air Pollution at the National Level using the EVA Model System docx
... 7.83E+ 05 6 .54 E+ 05 6.47E+ 05 4.25E+ 05 Bronchodilator Use Adults 3. 71E+ 05 3. 10E+ 05 3. 07E+ 05 2.02E+ 05 Cough Children 8.06E+ 05 6.73E+ 05 6.66E+ 05 4 .37 E+ 05 Cough Adults 2 .51 E+ 05 2.14E+ 05 2.15E+ 05 1.41E+ 05 ... 3. 26E+06 3. 11E+06 3. 60E+06 Lower Respiratory Symptoms Adults 3. 63E+ 03 3 .50 E+ 03 3.40E+ 03 4.47E+ 03 Acute YOLL 5. 25E+ 05 5.12E+ 05 4.88E+ 05 5.66E+ 05 Chronic YOLL 5. 16E+01 5. 04E+01 4.80E+01 5. 56E+01 Infant ... 161.1 289.8 30 .0 BaS-NoS/ 15 2011 43. 8 1 03. 2 289.8 20.7 BaS-NoS/ 15 2020 53 . 5 15. 6 2 93. 4 13. 9 BaS-NoS/ 15 All/all 2000 24089.9 10298 .3 6102.6 51 95. 8 32 72.0 2007 19448 .5 8278.7 59 03. 5 4 655 .0 2718.4...
Ngày tải lên: 29/03/2014, 14:20
Báo cáo khoa học: Functional analysis of pyrimidine biosynthesis enzymes using the anticancer drug 5-fluorouracil in Caenorhabditis elegans docx
... in the C elegans genome Both 5dFUR and 5- FU, however, exhibited similar effects on wild-type worms, and growth of the upp-1 mutant on the 5dFUR plate resembled that on the 5- FU plate (Fig 3C) The ... vitro (Fig 3A) The growth rates of these upp-1 mutants were also similar to each other (Fig 3B) Next, we treated wild-type and upp-1 mutant worms with 5 -deoxy -5- fluorouridine (5dFUR) to further examine ... particular, 5- FU is a primary therapy for colorectal cancer [2] Like other pyrimidine antagonists, 5- FU is a prodrug that is converted to the active form via the pyrimidine biosynthesis pathway [3] Therefore,...
Ngày tải lên: 30/03/2014, 01:20
Apress beginning iOS 5 games development, using the iOS 5 SDK for ipad iphone and ipod touch (2011)
... from the library item A onto each of the views We gave the UIButton on the left the label Play, and the UIButton on the right the label Back To make the Play button navigate to the view on the ... 30 0 GIMP .30 1 Blender 3D .30 2 Inkscape .30 3 Summary 30 4 Index 30 5 viii About the Author Lucas ... or retrieval system, without the prior written permission of the copyright owner and the publisher ISBN- 13 (pbk): 978-1- 430 2 -37 10 -5 ISBN- 13 (electronic): 978-1- 430 2 -37 11-2 Trademarked names, logos,...
Ngày tải lên: 24/04/2014, 10:13
Báo cáo toán học: "A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3'''', 5''''-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pot
... isozyme genes (protein_id 10 957 , 121822, 10 131 738 , 6811, 11110, 122202, 88 95, 121806, 131 707, 131 709), mnp isozyme genes (protein_id 140708, 35 89, 878, 8191, 4 636 ), and cam (protein_id 10767) ... groups (P < 0. 05) , estimated by Turkey’s HSD test following one-way factorial ANOVA Primers 5' -CGTCAACGACCCCTTCATTG -3' and 5' -CGACATAGAGCTTGCCGTCCT -3' were used for the gpd gene The other primers ... Arch Biochem Biophys 234 : 35 3 -36 2 Heinzkill M, Messner K (1997) The ligninolytic system of fungi In: Anke T (ed) Fungal biotechnology Chapman & Hall, Weinheim, Germany pp 2 13- 227 Kirk TK, Connors...
Ngày tải lên: 20/06/2014, 20:20
báo cáo hóa học:" A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3’, 5’-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pot
... 10 957 , 121822, 131 738 , 6811, 11110, 122202, 88 95, 121806, 131 707, 131 709), mnp isozyme genes (protein_id 140708, 35 89, 878, 8191, 4 636 ), and cam (protein_id 10767) An actin gene (protein_id 139 298) ... Sci USA 89 :55 86 55 90 doi:10.10 73/ pnas.89.12 .55 86 Bumpus J, Tien M, Wright D, Aust S (19 85) Oxidation of persistent environmental pollutants by a white rot fungus Science 228:1 434 –1 436 doi:10.1126/ ... groups (P < 0. 05) , estimated by Turkey’s HSD test following one-way factorial ANOVA Primers 5 CGTCAACGACCCCTTCATTG -3 and 5 -CGACATAGAGCTTGCCGTCCT -3 were used for the gpd gene The other primers...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: "A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3’, 5’-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pptx
... 10 957 , 121822, 131 738 , 6811, 11110, 122202, 88 95, 121806, 131 707, 131 709), mnp isozyme genes (protein_id 140708, 35 89, 878, 8191, 4 636 ), and cam (protein_id 10767) An actin gene (protein_id 139 298) ... Sci USA 89 :55 86 55 90 doi:10.10 73/ pnas.89.12 .55 86 Bumpus J, Tien M, Wright D, Aust S (19 85) Oxidation of persistent environmental pollutants by a white rot fungus Science 228:1 434 –1 436 doi:10.1126/ ... groups (P < 0. 05) , estimated by Turkey’s HSD test following one-way factorial ANOVA Primers 5 CGTCAACGACCCCTTCATTG -3 and 5 -CGACATAGAGCTTGCCGTCCT -3 were used for the gpd gene The other primers...
Ngày tải lên: 21/06/2014, 19:20
The value of Zeta(3) to 1,000,000 Places potx
... ——————————————— | |/ 3| | ——— (3 n + 2)! ((4 n + 3) !) | \ n >= / with A(n) := 12 639 2 n + 412708 n + 53 1 57 8 n + 33 636 7 n + 104000 n + 124 63 given by Theodor Amdeberhan and Doron Zeilberger (see [1]) ... equals 1.202 056 9 031 … Editor: Simon Plouffe April, 2001 [Etext # 25 83] Project Gutenberg Etext The value of Zeta (3) to 1,000,000 Places ******This file should be named zeta310.txt or zeta310.zip****** ... plouffe@math.uqam.ca The value of Zeta (3) to 1,000,000 decimal digits the number is defined as sum(1/n ^3, n=1 infinity), the sum of inverses of cubes and equals 1.202 056 9 031 … Computed by : Sebastian...
Ngày tải lên: 28/06/2014, 19:20