... finite element method is applied MODELLING OF MATERIAL PROPERTIES Theorical simulation of the deformation process of wood during drying or other types of moisture variation requires a proper constitutive ... Element Method) Report TVSM -30 01, Lund Institute of Technology, Division of Structural Mechanics, Lund, Sweden Hibbitt, Karlsson and Sorensen, Inc (19 93) ABAQUS, Version 5 .3 Pawtucket, RI, USA Mishiro ... In:IUFRO /5. 02 TimberEngineering Meeting New Brunswick, Canada Wormuth EW (19 93) Study of the relation between flatwise and edgewise modulus of elasticity of sawn timber for the purpose of improving...
Ngày tải lên: 08/08/2014, 18:21
... Kang N., Riffkin C.D., Drinkwater R., SNPs in animal genetics [54 ] [55 ] [56 ] [57 ] [58 ] [59 ] [60] [61] [62] [ 63] [64] [ 65] [66] 30 3 Moore S.S., Dodds K.G., Lumsden J.M., van Stijn T.C., Phua S.H., ... chromosome 5, in which 11 blocks of low haplotype diversity covered more than 75% of the sequence [17] A study of 1 35 kb out of nine genes, has also revealed long stretches of linkage disequilibrium, ... ratio of 1.7 [ 63] The results obtained to date in chickens indicate higher ratios than in mammals: SNPs mined from EST sequence traces gave a ratio of 2 .3 [74] or [39 ] and a survey of 138 SNPs...
Ngày tải lên: 09/08/2014, 18:21
Focused and unfocused written corrective feedback on tenses and other types of errors
... errors 20 50 50 120 40 50 50 140 60 40 40 140 No of other errors 40 30 20 90 25 50 30 1 05 35 40 30 1 05 Total No of errors 60 80 70 210 65 100 80 2 45 95 80 70 35 0 Total Word Used 150 100 100 35 0 120 ... errors 44 55 60 159 48 60 30 138 66 65 79 210 Total Word Used 120 120 120 36 0 110 110 110 33 0 100 100 100 30 0 No of tense errors 33 30 30 93 12 35 35 82 40 40 40 120 No of other errors 44 30 30 104 ... 100 110 30 0 100 150 100 35 0 120 110 120 35 0 No of tense errors 20 50 50 120 40 50 50 140 60 40 40 140 No of other errors 40 30 20 90 25 50 30 1 05 35 40 30 1 05 Total No errors 60 80 70 210 65 100...
Ngày tải lên: 30/09/2015, 10:11
Tài liệu Lab 3.2.5 Configuring Message-of-the-Day (MOTD) pptx
... command mode Upon completion of the previous steps, logoff by typing exit Turn the router off 2-4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2 .5 Copyright 20 03, Cisco Systems, Inc Erasing ... Enter The router is ready for the assigned lab to be performed 3- 4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2 .5 Copyright 20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet ... possible combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an...
Ngày tải lên: 24/01/2014, 19:20
Tài liệu Lab 3.2.5 Configuring Message of the Day pdf
... command mode Upon completion of the previous steps, logoff by typing exit Turn the router off 2-4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2 .5 Copyright 20 03, Cisco Systems, Inc Erasing ... Enter The router is ready for the assigned lab to be performed 3- 4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2 .5 Copyright 20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet ... possible combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an...
Ngày tải lên: 24/01/2014, 19:20
Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx
... 70.2(8), 59 .5( 6) 70 .5( 7) 67.0(4b), 55 .5( 9) 63. 5( 4a,1) 55 .7(8a) [1- C]Glucose [carboxy-13C]Shikimate %13Cb %13C13Cc %13Cb %13Cb 4.6 4.2 4 .3 4 .5 4.7 4.0 4 .3 4.6 28.9(2), 29.9(8b) 31 .1(1), 28.8 (3) 55 .8(4, ... 28.8 (3) 55 .8(4, 2) 28 .3( 4), 31 .2(8b) 68.9(8a) 29 .5( 4a), 29 .5 (3) 16.8(6, 7) 15. 5 (5, 7), 45. 2(7) 11.2(8), 56 .8(6, 8) 65. 8(7) 19.6(4b), 63. 3(4b, 9) 60.2(4a, 1) 56 .4(8a) 1 .5 6.2d 1 .5 1.4 7.2 6.0 1.9 ... cultures of S chirata Precursor Chemical shifts (p.p.m.) d13C d1H JHH 6.17(d) 2.2(4) 6.41(d) 2.2(2) 7.16(d) 8.9(7) 6 .56 (d) 8.8(6) 4a 4b 164 . 35 99 . 35 168. 05 159 .36 1 45. 16 95. 49 138 .33 124.68 8a...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx
... PtdIns (3) P, PtdIns(4)P, PtdIns (5) P, PtdIns (3, 4)P2, PtdIns (3, 5) P2 and PtdIns(4 ,5) P2 have been detected In contrast, PtdIns (3, 4 ,5) P3 has not been identified in plants [9 ,36 ] Therefore, PtdIns (3, 5) P2 ... 3, 4-bisphosphate; PtdIns (3, 5) P2, phosphatidylinositol 3, 5- bisphosphate; PtdIns(4 ,5) P2, phosphatidylinositol 4 ,5- bisphosphate; PtdIns (3, 4 ,5) P3, phosphatidylinositol 3, 4 ,5- triphosphate, PE, phosphatidylethanolamine; ... series of 2272 PtdInsPs (Fig 6A) PCaP1 bound to phosphatidylinositol 3, 4-bisphosphate [PtdIns (3, 4)P2], PtdIns (3, 5) P2, PtdIns(4 ,5) P2 and phosphatidylinositol 3, 4 ,5- triphosphate [PtdIns (3, 4 ,5) P3],...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo toán học: "A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3'''', 5''''-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pot
... genes of ligninolytic peroxidase, i.e 10 lip isozyme genes (protein_id 10 957 , 121822, 10 131 738 , 6811, 11110, 122202, 88 95, 121806, 131 707, 131 709), mnp isozyme genes (protein_id 140708, 35 89, ... decomposition of synthetic [14C]ligins Proc Natl Acad Sci USA 72: 251 5- 251 9 Kirk TK, Farrell RL (1987) Enzymatic “combustion”: the microbial degradation of lignin Annu Rev Microbiol 41:4 65- 5 05 Kirk TK, ... buffer (pH 3. 0), and 250 µM H2O2 The extinction coefficient of veratryl aldehyde (oxidized veratryl alcohol) at 31 0 nm is 9 ,30 0 M-1cm-1 One unit of enzyme activity represents the oxidation of veratryl...
Ngày tải lên: 20/06/2014, 20:20
báo cáo hóa học:" A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3’, 5’-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pot
... Sci USA 89 :55 86 55 90 doi:10.10 73/ pnas.89.12 .55 86 Bumpus J, Tien M, Wright D, Aust S (19 85) Oxidation of persistent environmental pollutants by a white rot fungus Science 228:1 434 –1 436 doi:10.1126/ ... 10 957 , 121822, 131 738 , 6811, 11110, 122202, 88 95, 121806, 131 707, 131 709), mnp isozyme genes (protein_id 140708, 35 89, 878, 8191, 4 636 ), and cam (protein_id 10767) An actin gene (protein_id 139 298) ... decomposition of synthetic [14C]ligins Proc Natl Acad Sci USA 72: 251 5– 251 9 doi:10.10 73/ pnas.72.7. 251 5 Kirk TK, Farrell RL (1987) Enzymatic “combustion": the microbial degradation of lignin Annu...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: "A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3’, 5’-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium" pptx
... Sci USA 89 :55 86 55 90 doi:10.10 73/ pnas.89.12 .55 86 Bumpus J, Tien M, Wright D, Aust S (19 85) Oxidation of persistent environmental pollutants by a white rot fungus Science 228:1 434 –1 436 doi:10.1126/ ... 10 957 , 121822, 131 738 , 6811, 11110, 122202, 88 95, 121806, 131 707, 131 709), mnp isozyme genes (protein_id 140708, 35 89, 878, 8191, 4 636 ), and cam (protein_id 10767) An actin gene (protein_id 139 298) ... decomposition of synthetic [14C]ligins Proc Natl Acad Sci USA 72: 251 5– 251 9 doi:10.10 73/ pnas.72.7. 251 5 Kirk TK, Farrell RL (1987) Enzymatic “combustion": the microbial degradation of lignin Annu...
Ngày tải lên: 21/06/2014, 19:20
English Language Tests-Intermediate level''''s archiveReal Life: Types of Buildings (3) ppt
... warehouse 5. A is a building that houses ancient and historical artifacts and other items of interest These places put items on display and try to preserve art and historical items of value city ... dormitory garage 3. A is a building that is used to house and treat people who are needy or ill Doctors, nurses and patients are found in this kind of building hospital city hall post office castle ... it Airplanes fly into and out of these places on a regular basis airport train station ski lodge pyramid 9.A is a large building that stores merchandise and other various products on a large...
Ngày tải lên: 25/07/2014, 07:20
Báo cáo toán học: " Completion of the Wilf-Classification of 3-5 Pairs Using Generating Trees" pps
... sn ( 132 , 4 35 21) = sn ( 132 , 5 234 1) = sn ( 132 , 53 2 41); sn ( 132 , 34 2 15) = sn ( 132 , 4 231 5) ; sn ( 132 , 32 1 45) = sn ( 132 , 432 51 ); sn ( 132 , 45 231 ) = sn ( 132 , 4 53 1 2); and sn ( 132 , 4 53 2 1) = sn ( 132 , 53 4 21) ... 32 4 15) = sn ( 132 , 32 451 ) = sn ( 132 , 34 1 25) = sn ( 132 , 34 251 ) = sn ( 132 , 34 51 2) 3n−1 + ; = sn ( 132 , 4 2 35 1) = sn ( 132 , 4 35 12) = the electronic journal of combinatorics 13 (2006), #R31 sn ( 132 , 34 52 1) ... avoiding 132 For τ of length 5, their results lead to the following nontrivial Wilf-equivalences: sn ( 132 , 1 234 5) = sn ( 132 , 2 134 5) = sn ( 132 , 231 45) = sn ( 132 , 234 15) = sn ( 132 , 234 51 ) = sn ( 132 , 32 4 15) ...
Ngày tải lên: 07/08/2014, 13:21
Báo cáo khoa học: "Circadian variations of serum thyroxine, free thyroxine and 3, 5, 3''''triiodothyronine concentrations in healthy dogs" potx
... p** ,50 .0 < p* 41.0 ± 49.0 11.0 ± 60.1 *31 .0 ± 53 . 1 *21.0 ± 03. 1 80.0 ± 79.0 )ld/gn( 4Tf 30 .0 ± 64.0 30 .0 ± 73. 0 30 .0 ± 44.0 40.0 ± 24.0 50 .0 ± 34 .0 )lm/gn( 3Tt * 23. 0 ± 09.2 ** 83. 0 ± 45 .3 **72.0 ... ,00 : 71 ta )64.4 ot 93. 1( ld/gµ 30 .1 ± 09.2 ,00 : 41 ta )37 .5 ot 69.1( ld/gµ 51 .1 ± 45 .3 ,00 : 11 ta )64.4 ot 88.1( ld/gµ 68.0 ± 82 .3 ,00 : ta ) 23. 3 ot 35 .0( ld/gµ 57 .0 ± 57 .1 saw noitartnecnoc ... 95. 0( ld/gn 23. 0 ± 49.0 dna 00 : 71 ta )46.1 ot 56 .0( ld/gn 43. 0 ± 50 .1 ,00 : 41 ta )79.1 ot 79.0( ld/gn 21.0 ± 53 . 1 ,00 : 11 ta )9.1 ot 37 .0( ld/gn 73. 0 ± 03. 1 ,00 : ta )72.1 ot 6.0( ld/gn 54 2.0...
Ngày tải lên: 07/08/2014, 18:21
IntroductionAs part of the .NET Framework 3.5 ppsx
... configuration of the profiling service is outside of the scope of this whitepaper, it is worthwhile to note that groups as defined in profile configuration settings will be accessible as sub-properties of ... property of the ScriptManager control’s ProfileService child node Note that the location of the default profile service does not change However, ASP.NET AJAX allows you to specify the location of ... Client script would be able to access Name, Address.Line1, Address.Line2, Address.City, Address.State, Address.Zip, and BackgroundColor as properties of the properties field of the ProfileService...
Ngày tải lên: 08/08/2014, 19:20
báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf
... 5 ACCAAGCCCAAGTGATAAGC -3 ; F3H-F, 5 AGTGGTGAATTCGAATAGCAGTAG -3 and F3H-R, 5 -TTTCCTCCTGTACATTTCTGCAA -3 ; F3’H-F, 5 GAGGAGTTCAAGTTAATGGTGGT -3 and F3’H-R, 5 -ACTCGCTTTTCCTTGTGTTCTT -3 ; ANT1 (77 93) ; JAF 13- F, 5 -AGGAGAGTTCAGGAGCTGGAG -3 ; ... PAL5-F, 5 TTTCTCCATTACAAATCAAACCA -3 and PAL5-R, 5 -TTCACTTCATCCAAATGACTCC -3 , CHS2 LOC7782 95 (7794); DFR LOC544 150 (77 95) ; FLS-F, 5 TAAGATTTGGCCTCCTCCTG -3 and FLS-R, 5 ACCAAGCCCAAGTGATAAGC -3 ; ... program was as follows: 95 C for min, followed by cycles of 95 C for min, 40°C for and 72°C for 1 .5 Then 35 cycles of 95 C for 30 sec, 55 °C for 30 sec and 72°C for 1 .5 At the end there was an...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: " Impact on respiratory tract infections of heptavalent pneumococcal conjugate vaccine administered at 3, 5 and 11 months of age" potx
... 82 ( 75 104) 140 (128– 155 ) 34 0 (32 8 36 1) 55 1 (67.9) 82 (76–1 03) 1 43 ( 130 – 158 ) 34 3 (33 1 36 4) 476 (64.1) 0.96 0. 93 0.92 0.11 52 7 ( 65. 0) 33 (24–49) 35 (21 50 ) (2–4) 498 (66.9) 33 (20–46) 35 (21 51 ) ... 25 30 months Episodes/100 child-years PCV-7 group (n = 811) Control group (n = 744) 637 39 .2 156 38 .4 1 95 48.0 144 35 .5 142 35 .0 698 46.9 156 41.9 220 59 ,1 162 43. 5 160 43. 0 RR 95% CI P 0. 83 ... (0–2) 194 ( 23. 9) (0–2) 182 (24 .5) 1.00 0.84 284 ( 35 .0) 231 (31 .0) 0.10 79 (9.7) 33 (4.1) 111 ( 13. 7) 78 (9.6) 12 (1 .5) 65 (8.7) 44 (5. 9) 94 (12.6) 58 (7.8) 10 (1 .3) 0 .55 0.11 0 .59 0. 23 0.99 No significant...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo y học: " Differential temporal profile of lowered blood glucose levels (3.5 to 6.5 mmol/l versus 5 to 8 mmol/l) in patients with severe traumatic brain injury" docx
... (3 15) 10 (3 15) EDH (3. 5% ) (2.6%) SDH (7%) 12 (10 .5% ) Contusions 15 ( 13. 2%) 15 ( 13. 2%0 CT lesions (n [%]) Generalized oedema (6.1%) (7.9% tSAH (2.6%) (5 .3% ) mixed lesions 77 (67 .5% ) 69 (60 .5% ) ... (18–81) 38 (18–81) AIS head (mean [range]) 25 (9 36 ) 25 (9 36 ) AIS without head (mean [range]) 16 (1 55 ) 16 (1 55 ) ISS (mean [range]) 34 (16 54 ) 34 (12–67) Injured organs (n [range]) (1 5) (1 5) Initial ... (0.7 3. 4); NS 3. 5 (1 .5 3. 9) Blood glucose < lower limit (n [%]) 47/ 85 (55 %)* 24/92 (26%) Episodes (median [range]) (1–6) (1–11) Week 55 %* 28% Week 24% 36 % Week 21% 36 % Time point of occurrence...
Ngày tải lên: 13/08/2014, 11:22
chapter 3 types of e-business models and markets
... between front office and back office Operational CRM: The automation of horizontally integrated business processes involving “front office” customer touch points Personalization: The use of new and ... competition from airlines and other travel sites, led Wall Street to trade Priceline.com’s stock down to less than $3 per share in December 2000, from a high of $104. 25 in March 2000 First-to-market ... force of the business? The greatest strength of the Internet is its ability to bring together people, governments, and businesses and facilitate the flow of information among them This is one of...
Ngày tải lên: 13/11/2014, 12:59
Synthesis and biological investigation of pyrimido 1,2 a 1,3,5 triazine and its analogues 2
... H3C O S O O NH HN O Cl N N Lapatinib 1 93 F N O thymidylate synthase (1f28)169 S CH3 HN - 0 .56 67 H2N 0 .5 833 0 .57 14 0 .57 75 0 .56 0.6102 0 .5 932 0. 53 8 5 0. 53 1 3 N Nolatrexed (thymitaq) O H N N 0.6 034 ... homolog, mitochondrial - 1tv5, 3i68, 3i 65, 1tv5 3. 469 0 .37 14 16 Mitogen-activated protein kinase 14 Involved in MAP kinase activity 3e92, 3d 83, 3e 93, 3fc1, 3. 441 0 . 35 14 11 12 1 63 3huc Beta-secretase ... 1bkg, 2q7w, 3k7y, 3meb, 1map 3. 338 0 .3 2.9 45 0 .3 33 34 Branched-chain-aminoacid aminotransferase, mitochondrial Amino acid transport and metabolism 1kt8, 1kta, 1iye, 3ht5, 3csw 35 Heat shock...
Ngày tải lên: 10/09/2015, 15:49
Synthesis and biological investigation of pyrimido,1,2 a ,1,3,5,triazine and its analogues 1
... N3(A) N9(C) 28.28 0.00 2.88 3. 45 27.21 2 .30 0.00 3. 65 24.11 0.00 3. 28 2. 83 24. 25 1.80 0.00 3. 58 23. 37 0.00 5. 02 4. 15 30 .09 3. 47 4.24 0.00 4.24 31 1G** B3LYP/6 -31 1G** MP2/ 631 1G** # A basis set is ... + NH2 CN N N 34 N NaOMe OMe 25a N R NH2 N N N 35 No R Conditions Yield (%) 35 a α-D-ribofuranosyl anhyd MeOH, 15 C, 24h 39 35 b α-D-2-deoxyribofuranosyl anhyd DMSO, 55 °C, 15h 34 35 c (2-hydroxyethoxy)methyl ... 29.4±0 .3 11.6±0 .3 150 d 4-ClC6H4 22.9±0.4 15. 8±0.4 150 e 4-CF3C6H4 19 .5 0 .3 16.7±0 .3 150 f 4-CNC6H4 15. 6±0.4 3. 4±0.4 150 g 2-Furyl 33 .2±0.4 17.4±0.4 150 h 4-BrPh 27.6±0.4 14.7±0 .5 *± S.D; n =3 Reference...
Ngày tải lên: 10/09/2015, 15:49