... 22 6 22 6 22 7 22 7 22 7 22 9 23 0 23 2 23 2 23 4 23 8 23 9 23 9 24 0 24 2 24 4 24 5 24 6 24 8 24 9 25 1 25 2 25 4 25 5 25 7 25 8 25 9 [ viii ] Table of Contents A new form has been created The Page Rendering phase 25 9 26 0 ... 29 1 29 2 29 2 29 2 29 2 2 93 2 93 29 4 29 5 29 6 29 7 29 9 29 9 30 0 30 0 30 0 30 1 30 1 30 2 30 2 30 4 30 4 30 6 30 6 30 7 30 8 30 8 30 9 31 0 31 0 31 2 How does the Tabular Form wizard organize the data on a page? 31 3 Report ... 12: APEX Forms Sources for creating a form Creating a new form The form primary key The form items The form DML options The form branches 21 8 21 8 21 9 21 9 22 0 22 1 22 1 22 2 22 4 22 4 22 5 22 6 22 6 22 6...
Ngày tải lên: 14/03/2014, 13:20
... 3. 5158 2. 281 2 . 32 9 2. 076 2. 0 02 7.8 73 8 .2 63 8.910 8. 9 32 17 .34 0 7 . 32 9 12 .36 8 12. 424 11.746 17.500 6. 736 6 .24 2 22 .5 53 22 .570 21 .458 19 .28 5 11 .34 2 9.806 23 5 23 5 23 5 23 5 78 23 5 23 5 23 5 23 5 20 0 23 5 85 23 5 ... 29 8- 12 43 29 8- 12 43 29 8- 12 43 29 8- 12 43 2 93- 12 73 2 93- 12 73 2 93- 12 73 2 93- 12 73 2 93- 12 73 2 93- 12 73 2 93- 12 73 K K K K K K K K K K K K K K K K K K -2. 1 -2 .3 -2. 6 26 .8 11.7 4.7 0 .3 -2. 7 -5 .2 -0.5 22 .6 11 .2 ... 10 93- 1 23 3 10 93- 1 23 3 10 93- 1 23 3 CaCO,, aragonite a b 2 93- 6 73 K 2 93- 6 73 K c v a 2 93- 6 73 K 2 93- 6 73 K 29 7-11 73 K c v a c v a 29 7-11 73 29 7-11 73 2 93- 5 93 2 93- 5 93 2 93- 5 93 29 7-9 73 c v 29 7-9 73 29 7-9 73 CaCOa...
Ngày tải lên: 17/03/2014, 14:09
Chapter 131. Diphtheria and Other Infections Caused by Corynebacteria and Related Species (Part 3) ppsx
... of the submandibular and paratracheal region and is further characterized by foul breath, thick speech, and stridorous breathing The diphtheritic pseudomembrane is gray or whitish and sharply ... psoriasis, and venous stasis disease The lesions rarely exceed cm Figure 131 -2 Cutaneous diphtheria due to nontoxigenic C diphtheriae on the lower extremity (From the Centers for Disease Control and ... Republic in 1995, myocarditis was seen in 22 % and neuropathy in 5% of hospitalized patients The mortality rate was 7% among patients with myocarditis as opposed to 2% among those without myocardial manifestations...
Ngày tải lên: 08/07/2014, 02:20
The Phantom Rickshaw And Other Ghost Stories By Rudyard Kiping pot
... night, and he said to me:—‘Mangal Khan, brandy‐pani do,ʹ and I filled the glass, and he bent over the 27 The Phantom Rickshaw and Other Ghost Stories table to strike, and his head fell lower and lower till it hit the table, ... them. Up till that hour I had sympathized with Mr. Besant‘s method 23 The Phantom Rickshaw and Other Ghost Stories of handling them, as shown in “The Strange Case of Mr. Lucraft and Other Stories.” I am now in the Opposition. ... the many that I had ever set foot in. There was no fireplace, and the windows would not open; so a brazier of charcoal would have been 24 The Phantom Rickshaw and Other Ghost Stories useless. The rain and the wind splashed and gurgled and ...
Ngày tải lên: 30/03/2014, 13:20
Chapter 131. Diphtheria and Other Infections Caused by Corynebacteria and Related Species (Part 6) doc
... pharynx and skin C xerosis is found on the skin, nasopharynx, and conjunctiva; C auris in the external auditory canal; and C striatum in the anterior nares and on the skin C jeikeium and C urealyticum ... organism causes a diphtheria like illness and produces both diphtheria toxin and a dermonecrotic toxin C ulcerans is a commensal in horses and cattle and has been isolated from cow's milk The ... antitoxin and antibiotics should be initiated when respiratory C ulcerans is identified, and a contact investigation (including throat cultures to determine the need for antimicrobial prophylaxis and...
Ngày tải lên: 08/07/2014, 02:20
Chapter 131. Diphtheria and Other Infections Caused by Corynebacteria and Related Species (Part 7) pdf
... Livingstone, 20 05, pp 24 65 24 78 Pichichero ME et al: Combined tetanus, diphtheria, and 5-component pertussis vaccine for use in adolescents and adults JAMA 2 93: 30 03, 20 05 [PMID: 15 933 2 23 ] Bibliography ... in adults Vaccine 25 :34 64, 20 07; Epub 20 07 Jan Meyer DK, Reboli AC: Other coryneform bacteria and Rhodococcus, in Principles and Practice of Infectious Diseases, 6th ed, GL Mandell et al (eds) ... Control and Prevention: Availability of diphtheria antitoxin through an investigational new drug protocol MMWR 53: 4 13, 20 04 ———: Vaccine preventable deaths and the Global Immunization Vision and...
Ngày tải lên: 08/07/2014, 02:20
Chapter 131. Diphtheria and Other Infections Caused by Corynebacteria and Related Species (Part 1) pptx
... particularly in South Dakota, Ontario, and Washington state Immunity induced by vaccination during childhood gradually decreases in adulthood An estimated 30 % of men 60–69 years old have antitoxin ... 19 72 19 82 included 1100 cases, primarily manifesting as cutaneous disease During the 1990s in the states of the former Soviet Union, a much larger diphtheria epidemic caused >150,000 cases and ... frequent vaccine shortages, delays in implementation of vaccination and of treatment in response to cases, and lack of public education and awareness were contributing factors in that outbreak Cutaneous...
Ngày tải lên: 08/07/2014, 02:20
Chapter 131. Diphtheria and Other Infections Caused by Corynebacteria and Related Species (Part 4) ppsx
... new drug protocol and may be obtained by calling the Bacterial Vaccine Preventable Disease Branch of the National Immunization Program at 404- 639 - 825 7 between 8:00 A.M and 4 :30 P.M U.S Eastern ... children, 12, 500 25 ,000 U/kg) IM every 12 h until the patient can swallow comfortably, after which oral penicillin V is given at 125 – 25 0 mg four times daily to complete a 14-day course; or (2) erythromycin ... not characteristic and are clinically indistinguishable from other dermatoses Diphtheritic ulcers occasionally—but not consistently—have a punched-out appearance (Fig 131 -2) Patients in whom...
Ngày tải lên: 08/07/2014, 02:20
Chapter 131. Diphtheria and Other Infections Caused by Corynebacteria and Related Species (Part 5) docx
... toxoid, and acellular pertussis vaccine formulated for adolescents and adults Tdap was licensed for use in the United States in 20 05 and is the recommended booster vaccine for children 11– 12 years ... diphtheria and tetanus toxoids and acellular pertussis vaccine, adsorbed) is the currently recommended vaccine for children up to the age of 7; DTaP replaced DTP (diphtheria and tetanus toxoids and ... recommended booster vaccine for children 11– 12 years old and the recommended catch-up vaccine for children 7–10 and 13 18 years old As of 20 06, it is recommended that (1) adults 19–64 years old...
Ngày tải lên: 08/07/2014, 02:20
Báo cáo y học: "Reduced trabecular bone mineral density and cortical thickness accompanied by increased outer bone circumference in metacarpal bone of rheumatoid arthritis patients: a cross-sectional study" ppt
... 1. 03 0. 23 1.09 0.17 0.087 -5.5 Total CSA (mm2) 33 9 .3 55 .3 338 .4 48 .2 0.599 0 .3 (mg/cm3) 30 5 .3 58 .2 32 5.5 53. 1 0.076 -6 .2 Trab BMD (mg/cm3) 151.6 47 .3 186.1 38 .4 0.000 -18.5 BMC (g/cm) 0.89 0 .21 ... 1.18 to 2. 14 Total CSA (mm2) 124 .1 2. 82 2 .27 1. 72 to 2. 77 37 3.6 3. 69 0.99 0.77 to 1 .24 Total BMD (mg/cm3) 33 1.0 8.10 2. 45 1.96 to 2. 99 BMC (mg/mm) 52. 4 0.71 1 .35 0.98 to 1.70 Total CSA (mm2) 75.7 ... 22 2.9 37 .3 0.000 - 13. 6 Total BMD 66% BMC (g/cm) 3. 54 0.54 3. 72 0. 43 0.085 -4.8 Total CSA (mm2) 549.9 81.4 548 .3 67.6 0.956 0 .3 Cort CSA [mm2) 26 6.4 43. 9 28 2.6 33 .4 0.048 -5.7 1,117.0 54.8 1 130 .6...
Ngày tải lên: 12/08/2014, 14:22
Báo cáo y học: " Reducing ventilator-induced lung injury and other organ injury by the prone position" ppt
... Lancet 20 03, 36 1 :33 2 -34 0 Ranieri M, Giunta F, Suter PM, Slutsky A: Mechanical ventilation as a mediator of multisystem organ failure in acute respiratory distress syndrome JAMA 20 00, 28 4: 43- 44 ... Care Med 20 05, 33 :36 1 -36 7 Mentzelopoulos SD, Roussos C, Zakynthinos E: Prone position reduces lung stress and strain in severe acute respiratory distress syndrome Eur Respir J 20 05, 25 : 534 -544 ... mechanical ventilation and end-organ epithelial cell apoptosis and organ dysfunction in an experimental model of acute respiratory distress syndrome JAMA 20 03, 28 9 :21 04 -21 12 ...
Ngày tải lên: 12/08/2014, 23:23
RESEARCH ON THE CHANGE OF 2-AP AND OTHER VOLATILE COMPOUNDS IN PROCESSING BUN FROM RICE
... pandan leaf 20 67 23 1 3 2- AP in old pandan leaf 31 77 631 5 Table Content of - AP (ng/kg) in the pandan leaves quantified by SDE-GCFID Pandan leaves Young pandan leaf Mature pandan leaf Old pandan leaf ... 400C to 22 00C at a rate of 30 C/min and finally maintained at 22 00C for min; - For SPME: from 40°C to 115°C at a rate of 3 C/min then from115°C to 22 0°C at 30 °C/min and finally maintained at 22 0◦C ... tetradecane ,2, 6,10-trimethyl- 23 nonanal nonanal 24 2, 4-pentanedione, 3- butyl- 25 3- nonen-1-ol 26 cyclohexanone, 5-methyl -2- (1-methylethyl)- cyclohexanol, 1-methyl-4-(1-methylethyl)- 27 2- nonenal 2- undecanone,6,10-...
Ngày tải lên: 28/08/2013, 16:28
Tài liệu TOEFL STUDY GUIDE PART 3-2 STRUCTURE AND WRITTEN EXPRESSION docx
... TIP 52 Seven Common Errors: Error #1 m Verb Tense and Agreement m Make sure the subject and verb agree in tense and in number Countries are singular Structure: Error Identification TIP 53 Seven ... pattern." "There is", "there are", "there were", "there was", "it is", and "it was" are examples of no main verb or subject and are classed as expressions Sentence Completion Tip 50 Strategy: Locate ... Structure: Error Identification TIP 53 Seven Common Errors: Error #2 Nouns Singular and plural nouns: Many plural nouns are followed by an s Singular nouns could be identified with a, an, or this...
Ngày tải lên: 24/12/2013, 19:15
Tài liệu Lab 3.1.2 Command Modes and Router Identification docx
... the previous steps, logoff by typing exit Turn the router off 3- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 1 .2 Copyright 20 03, Cisco Systems, Inc Erasing and reloading the router Enter ... return to global configuration mode Router(config-if)#exit 2- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 1 .2 Copyright 20 03, Cisco Systems, Inc Step Assign a name to the router a Router(config)#hostname ... 2: Routers and Routing Basics v 3. 0 - Lab 3. 1 .2 Copyright 20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface #2...
Ngày tải lên: 18/01/2014, 04:20
Tài liệu Lab 3.1.2 Command Modes and Router Identification doc
... the previous steps, logoff by typing exit Turn the router off 3- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 1 .2 Copyright 20 03, Cisco Systems, Inc Erasing and reloading the router Enter ... Step Exit the router 2- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 1 .2 Copyright 20 03, Cisco Systems, Inc a Enter exit at the prompt to close out ... 2: Routers and Routing Basics v 3. 0 - Lab 3. 1 .2 Copyright 20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface #2...
Ngày tải lên: 18/01/2014, 04:20
Tài liệu Lab 3.2.9 Copying, Editing, and Pasting Configurations pdf
... dialog, type N and press Enter When prompted to terminate autoinstall type Y and press Enter Press Enter again 4-7 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2. 9 Copyright 20 03, Cisco Systems, ... the previous steps, logoff by typing exit Turn the router off 5-7 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2. 9 Copyright 20 03, Cisco Systems, Inc Erasing and reloading the router Enter ... BHM(config-router)#network 1 72. 18.0.0 BHM(config-router)#exit BHM(config)#exit 2- 7 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2. 9 Copyright 20 03, Cisco Systems, Inc Step Save the Birmingham router configuration...
Ngày tải lên: 24/01/2014, 19:20
Tài liệu Lab 3.2.9 Copying, Editing, and Pasting Configurations doc
... internetwork is functioning 2- 7 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2. 9 Copyright 20 03, Cisco Systems, Inc ping the FastEthernet interface of the other router a From GAD, can ... the previous steps, logoff by typing exit Turn the router off 5-7 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2. 9 Copyright 20 03, Cisco Systems, Inc Erasing and reloading the router Enter ... configuration: - More Lines that appear after the word "End" 3- 7 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 2. 9 Copyright 20 03, Cisco Systems, Inc f At the end of each of the interface...
Ngày tải lên: 24/01/2014, 19:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... cytoplasmic mRNA by AU-rich elements: key FEBS Journal 27 7 (20 10) 133 1– 134 4 ª 20 10 The Authors Journal compilation ª 20 10 FEBS S Stasinopoulos et al 29 30 31 32 33 34 35 36 37 38 39 40 41 sequence ... Nucleotide sequence (5¢- to 3 ) Orientation SJS 133 SJS 134 SJS 137 SJS 138 SJS1 72 SJS1 73 SJS174 SJS175 SJS259 SJS260 SJS261 SJS2 62 SJS167 SJS170 ALS 030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC ... Plasminogen activator inhibitor 2: regulation of gene transcription during 134 2 17 18 19 20 21 22 23 24 25 26 27 28 phorbol ester-mediated differentiation of U- 937 human histiocytic lymphoma cells...
Ngày tải lên: 16/02/2014, 09:20