... Three kinds of grids in solving main variables 67 3. 11 U grid in two- dimensional domain 70 3. 12 V grid in two- dimensional domain 70 4.1 View of sample in cone calorimeter ... main grid and V velocity grid 63 3.7 Schematic of QUICK algorithm 64 3. 8 Procedure of PISO algorithm 66 3. 9 Main grid in two- dimensional domain 67 3. 10 Three kinds of grids ... Computational domain in FiresCone 53 3 .3 Structure of program 60 3. 4 Grids by finite volume method 61 3. 5 Discretization techniques for main grid and U grid 63 3.6 Discretization...
Ngày tải lên: 09/09/2015, 11:28
... systems, insurance policies, preventative medicine, etc.) not generate much emotional involvement and, therefore, may receive relatively low processing priority – unless emotional rewards can be invoked ... produkto kaina ir kokyb veikia vartotojo pasitenkinimą neuromarketingo požiūriu Vartotojų pasitenkinimas yra svarbus veiksnys, vedantis verslą į ilgalaikę s kmę Nors yra daug teorinių modelių, ... quality in services selling: An interpersonal influence perspective, Journal of Marketing 54 (3) : 68–81 Grönroos, C 1994 From Marketing Mix to Relationship Marketing: Towards a Paradigm Shift in Marketing...
Ngày tải lên: 08/06/2014, 11:34
Báo cáo hóa học: " Enhancement of critical heat flux in nucleate boiling of nanofluids: a state-of-art review" pot
... kg/m2s 53% Diamond (4 nm) Inlet subcooling:
Ngày tải lên: 21/06/2014, 03:20
Báo cáo y học: " Influence of flow on mucosal-to-arterial carbon dioxide difference" ppt
... 89: 131 7- 132 1 Nevière R, Chagnon J-L, Teboul J-L, Vallet B, Wattel FB: Small intestine intramucosal PCO2 and microvascular blood flow during hypoxic and ischemic hypoxia Crit Care Med 2002, 30 : 37 9 -38 4 ... Intensive Care Medicine, in Barcelona [4] In that new set of experiments conducted in sheep, ∆PCO2 did not increase when DO2 was lowered below its critical value during progressive severe anaemia ... Intramucosal-arterial PCO2 gap fails to reflect intestinal dysoxia in hypoxic hypoxia Crit Care 2002, 6 :in press Vallet B, Teboul JL, Cain S, Curtis S: Venoarterial CO2 difference during regional ischemic or hypoxic...
Ngày tải lên: 12/08/2014, 19:21
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt
... importin-b binding domain The importin-b binding domain is known to have an autoinhibitory function, whereby an internal NLS-like sequence competes for the importin-a binding site, reducing binding ... those observed in the importin-a:simian virus 40 (SV40) large T-antigen (TAg) NLS complex [ 13] This includes the key electrostatic interaction at P2 involving Lys2 03 and impa Asp192 In classical ... 0⁄6⁄0 ⁄ 31 ⁄ 1 ⁄ 20 ⁄ ⁄ 30 ⁄ 1 ⁄ 45 ⁄ 0⁄0⁄0 ⁄ 132 ⁄ 0.4 3. 5 2.2 3. 3 5.6 2.8 20.8 5 .3 15.9 8.0 13. 5 15.9 58.6 0.4 8.8 18.9 10.2 16.8 21.5 2.8 79.4 26.7 89.4 145 .3 128 .4 133 .8 174.8 46 .3 744.7...
Ngày tải lên: 14/02/2014, 19:20
Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot
... identification of a novel subunit of protein serine ⁄ threonine phosphatase J Biol Chem 274, 533 9– 534 7 FEBS Journal 2 73 (2006) 33 22 33 34 ª 2006 The Authors Journal compilation ª 2006 FEBS 33 33 Resistance ... tag PPH3 N-terminal 3HA tag PPH3 N-terminal 3HA tag PPG1 N-terminal 3HA tag PPG1 N-terminal 3HA tag SIT4 N-terminal 3HA tag SIT4 N-terminal 3HA tag (1) ATGAGCTCGACGATGTGGGATG (22) ( 132 3) TCTGGACTTCTTGCCTAATGGAC ... indicate the positions of YBL046w–MYC 13, HA3–Pph3p and the IgG heavy chain Molecular mass markers are indicated in kDa 33 28 FEBS Journal 2 73 (2006) 33 22 33 34 ª 2006 The Authors Journal compilation...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo hóa học: " Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" docx
... (0.45–0.75) ‡ 79 .3% (69%–87%) § 0.56 (0 .39 –0.74) ‡ Youden index = Sensitivity + Specificity – 1, 95% confidence interval in brackets, PPV = Positive Predictive Value, NPV = Negative Predictive Value, AUC ... predictive value) were removed, and worsening when such patients were included (case of the positive predictive value, Table 4) Validity in subgroups according to pain severity and educational level ... (46%) 12 (12% ) 14 (14%) (8%) 20 (35 %) 24 (41%) (3% ) (3% ) 10 (17%) SF-MPQ scoring; Sensory dimension (0 – 33 ): Affective dimension (0 – 12) : Total score (0 – 45): Pain in the previous week (VAS;...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" pdf
... (0.45–0.75) ‡ 79 .3% (69%–87%) § 0.56 (0 .39 –0.74) ‡ Youden index = Sensitivity + Specificity – 1, 95% confidence interval in brackets, PPV = Positive Predictive Value, NPV = Negative Predictive Value, AUC ... predictive value) were removed, and worsening when such patients were included (case of the positive predictive value, Table 4) Validity in subgroups according to pain severity and educational level ... (46%) 12 (12% ) 14 (14%) (8%) 20 (35 %) 24 (41%) (3% ) (3% ) 10 (17%) SF-MPQ scoring; Sensory dimension (0 – 33 ): Affective dimension (0 – 12) : Total score (0 – 45): Pain in the previous week (VAS;...
Ngày tải lên: 20/06/2014, 16:20
Influence of different breeds, feeding and housing systems on sow reproductive performance and piglet''''s resistance to diseases in Central Vietnam pdf
... University Total 35 81 54 10 186 35 81 54 10 186 3, 0000 2,9714 2,8148 2,8519 3, 0000 2,0000 2,8548 2,0000 3, 1429 3, 7654 3, 3889 2,7000 8,0000 3, 5215 3, 0000 3, 1666 2, 936 5 2,9861 3, 0000 4,4841 2, 932 3 ... 3, 0000 4,4841 2, 932 3 4,4841 4,0 012 4,4085 4, 2127 3, 1828 33 ,8159 3, 9572 1,00 1,00 1,00 2,00 3, 00 3, 00 1,00 1,00 1,00 1,00 1,00 2,00 2,00 1,00 3, 00 4,00 4,00 4,00 3, 00 3, 00 4,00 3, 00 12, 00 15,00 15,00 ... also associated with villas shortening 10 and crypt deepening and giving supplementary feed during the suckling period was effective in preventing villas shortening after weaning The more impacts...
Ngày tải lên: 21/06/2014, 06:20
Thu hồi đất đối với trường hợp quy định tại khoản 3, 4, 5, 6, 9, 11 và 12 Điều 38 Luật Đất đai (đối tượng là tổ chức, cơ sở tôn giáo, người Việt Nam định cư ở nước ngoài, tổ chức nước ngoài, cá nhân nước ngoài) pot
... Tối đa 35 ngày làm việc Đối tượng thực hiện: Tổ chức TTHC yêu cầu trả phí, lệ phí: Không Kết việc thực TTHC: Quyết định hành Các bước Mô tả bước Tên bước V n phòng Đăng ký đất Thông tin tài nguyên ... tin tài nguyên môi trường thời hạn 03 ngày V n phòng Đăng ký đất Thông tin tài nguyên môi trường chỉnh lý hồ sơ địa trao định cho người có liên quan thời hạn 02 ngày Hồ sơ Thành phần hồ sơ V n ... cho đơn v quản lý thời hạn 07 ngày Ủy ban nhân dân tỉnh ký định thu hồi giao đất, chuyển hồ sơ cho Sở Tài nguyên Môi trường thời hạn 03 ngày Sở Tài nguyên Môi trường nhận định chuyển cho V n phòng...
Ngày tải lên: 04/07/2014, 19:21
designing and using the concept map in teaching the part of genetics” in order to contribute to improvement of the teaching quality of biology subject of 12 grade
... thinking brain It is based on the rule of thinking that all information exists in the human brain needing to have interconnections in order to find and use However, comparing with mind maps and ... Graphs In terms of essence, the concept maps, mind maps and Graphs also are effective thinking tools, stimulate brain of activity and link ideas together All three types are indicative of thinking ... planning in teaching (teaching a topic, evaluation, etc) In Vietnam, the design and use of the concept maps are limited Most authors have just been interested in the role of the concept map in...
Ngày tải lên: 25/07/2014, 14:39
Báo cáo sinh học: "Dynamic rerouting of the carbohydrate flux is key to counteracting oxidative stress" pot
... MR1 23 This study MR 137 Mat a; his3∆1; leu2∆0; met15∆0; ura3∆0; tpi1::LEU2 zwf1::KanMX4 CEN-HIS3-GPDpr-hTPIIle170Val MR1 23 This study The deletion strains ∆tpi1∆zwf1 (MR1 23) , ∆tpi1∆sol3 (MR120) ... 265: 133 08- 133 13 Kamath RS, Ahringer J: Genome-wide RNAi screening in Caenorhabditis elegans Methods 20 03, 30 :31 3 -32 1 Log rank test [http://bioinf.wehi.edu.au/software/russell/logrank/index.html] Wamelink ... the amino acid isoleucine to valine at position 170 in the human TPI protein (TPIIle170Val) causes a reduction of about 70% in the enzyme’s catalytic activity [11] Interestingly, we discovered...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo vật lý: "Influence of the Silica-to-Surfactant Ratio and the pH of Synthesis on the Characteristics of Mesoporous SBA-15" ppt
... Pore volume (cc/g) S1 (R 1.52) 669 225 444 4.95 0.5 S2 (R 2.25) 536 214 32 2 4.86 0.42 S3 (R 3. 15) 520 205 31 5 4.57 0.42 S4 (R 3. 38) 510 246 264 4 .35 0 .35 S5 (pH 1 .3) 679 224 455 3. 64 0 .38 S6 ... 1.7) 646 268 37 8 4.15 0.49 S7 (pH 2.5) 530 2 23 307 4.74 0.58 S8 (pH 3. 0) 488 262 226 4.88 0.59 Note: R denotes ratio In this study, only pH values in the range of 1 .3 to 3. 0 were investigated, ... The decrease in these properties could be further observed from the data given in Table The samples were synthesised by varying the TEOS/TCP ratio but maintaining the pH value at 1.7 In each sample,...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo lâm nghiệp: " Influence of environmental conditions on radial patterns of sap flux density of a 70-year Fagus crenata trees in the Naeba Mountains, Japan" ppsx
... S.D Fin & Wet 2119 1 43 1661 157 757 121 78.4 35 .7 2161 90.2 3. 7 9.0 Cloud & Wet 133 6 278 1080 204 455 116 80.8 34 .1 138 0 68.0 3. 2 11.8 Fine & Dry 34 15 13 25 512 42 1 03. 6 35 .0 1761 61.2 3. 8 19.0 ... 2501 440 136 8 280 2 93 84 54.7 11.7 26 53 58.0 3. 8 3. 2 1704 405 1028 240 134 68 60 .3 7.9 1786 69.4 5.5 8 .3 Fine & Dry Tree C 1461 Fin & Wet Cloud & Wet Tree B 12 83 34 791 17 208 61.7 16.2 137 7 21.2 ... sensors were installed between the end of April before the leaves flushed The sensors were removed in November after leaves had fallen to avoid damage by heavy winter snow Healthy individual beech...
Ngày tải lên: 08/08/2014, 00:21
Báo cáo lâm nghiệp: "Influence of cross section dimensions on Timoshenko’s shear factor – Application to wooden beams in free-free flexural vibration" ppsx
... shows variations in the relative error for the first five vibration frequencies when comparing a calculation using the standard K value and a calculation using a K* value based on the variation in ... vibration analysis of clear wooden beams: a theoretical review, Wood Sci Technol 36 (2002) 34 7 36 5 [2] Cowper G.R., The shear coefficient in Timoshenko’s beam theory, J Appl Mech (1966) 33 5 34 0 ... was 0.8 23 instead of the standard 0. 833 In this case, the wooden beam was tested flatwise and its mechanical behavior began to resemble that of a thick plate Nevertheless, the relative error...
Ngày tải lên: 08/08/2014, 00:22
Báo cáo lâm nghiệp:"Influence of basic density and temperature on mechanical properties perpendicular to grain of ten wood tropical species" pot
... Hymenolobium 62 36 .6 4.7 58 40.8 4.0 59 45.2 5.6 Vouacapoua 61 43. 6 4.1 58 46.2 3. 7 58 44 .3 4.7 Tabebuia 60 33 .6 4.9 59 30 .6 3. 9 58 34 .6 5.6 Bocoa 65 27.1 4.7 59 32 .2 3. 3 64 30 .5 4.4 Table VI Values of ... 5164 5002 4827 4 730 49 13 4 734 4496 433 3 4022 37 74 35 31 32 43 2821 2517 2175 1908 1614 1441 12 63 120 0 0.944 Table III Values of the parameters calculated for criteria from shearing and fracture tests ... 2 .12 4497 2.09 432 2 2.11 4021 2.21 38 11 2.22 35 69 2.25 32 86 2. 23 2858 2.25 2557 2. 23 2201 2.24 1 932 2.09 16 13 2. 13 1446 2.09 126 4 2.09 120 4 0.945 W20% (case 2) a b 2. 13 5201 5164 5002 4827 4 730 ...
Ngày tải lên: 08/08/2014, 01:21
Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf
... NaCl causing a progressive decline in the growth rate and with complete inhibition of growth at 200 mM NaCl in the absence of proline Proline significantly improved cell growth at every concentration ... of proline in embryogenic cultures of larch, sitka spruce and oak is shown in Table I With no proline addition, intracellular proline levels are correspondingly low When proline is added, intracellular ... ± 0.0 23 0.02 83 ± 0.009 1.708 ± 0.029 1.621 ± 0. 036 0. 834 ± 0.017 10 9.829 ± 0.002 9. 632 ± 0.021 7.8107 ± 0.014 100 77. 938 ± 0. 012 76.572 ± 0.065 51.816 ± 0.091 Figure Influence of proline on...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo khoa học: "The influence of seed age on germinative response to the effects of fire in Pinus pinaster, Pinus radiata and Eucalyptus globulus" doc
... collected in the years mentioned All of the treatments consisted of six replicates of 30 seeds each, using the methodology of previous studies [36 , 37 , 38 ] Placing the seeds in a hot air oven for minutes ... using Multivariant Variance Analysis In order to increase normality, the germination percentage data was transformed using an Arc-sine Transformation, and the average germination time data using ... described several species of Pinus and Eucalyptus as serotinous [1, 2, 3, 4, 9, 10, 12, 14, 19, 28, 30 , 33 , 42, 46], although the degree of serotinity is not a constant characteristic It can vary from...
Ngày tải lên: 08/08/2014, 14:21