3 1 form of the lie brackets and the killing operators

Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

... variants: Noxo1b (AB097667, AF 532 984, and AF 539 796), Noxo1c (AF 532 985), Noxo1a (AY255768 and AF 532 9 83) , and Noxo1d (AY19 13 5 9) On the basis of the sequence of splice variants, we synthesized the full-length ... 269, 13 1 14 0 33 Harper RW, Xu C, Soucek K, Setiadi H & Eiserich JP (2005) A reappraisal of the genomic organization of human Nox1 and its splice variants Arch Biochem Biophys 435 , 32 3 33 0 34 Arbiser ... activity of the PX domains of Noxo1b and Noxo1c The membrane localization of Noxo1b is mediated in part by binding of the PX domain to membrane phospholipids [19 ] Less association of Noxo1c with the...

Ngày tải lên: 19/02/2014, 06:20

15 633 0
Báo cáo y học: "Inhibition of HIV-1 replication by P-TEFb inhibitors DRB, seliciclib and flavopiridol correlates with release of free P-TEFb from the large, inactive form of the complex" potx

Báo cáo y học: "Inhibition of HIV-1 replication by P-TEFb inhibitors DRB, seliciclib and flavopiridol correlates with release of free P-TEFb from the large, inactive form of the complex" potx

... replication J Biol Chem 2000, 275 (37 ):2 834 5-2 834 8 Page 11 of 12 (page number not for citation purposes) Retrovirology 2007, 4:47 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Mancebo HS, Lee G, ... (HEXIM1) [ 13 , 14 ] or HEXIM2 [15 ] In HeLa cells, between 50% and 90% of P-TEFb is present in the large form of the complex while the remainder of P-TEFb is in the kinase active, free form [9 ,10 ,14 ,15 ] ... poly(d) (T12 -18 ) and 10 µCi/ml 32 P-TTP The mixture was incubated at 37 °C for 3. 5 hours and then blotted onto DE 81 paper The DE 81 paper was washed times with 3 SSPE and the amount of radioactivity...

Ngày tải lên: 13/08/2014, 05:22

12 477 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

... PAI -1 variant Activity (%) t½ (min) Wild-type T96A F100A V126A F128A S129A E 13 0 A V 13 1 A E 13 2 A R 13 3 A R 13 5 A F 13 6 A I 13 7 A I 13 8 A N 13 9 A D140A W141A V142A K143A T144A H145A T146A K147A M149A N152A E283A ... M149K N152D G155P, K156S, G157E N152D, G155P, K156S, G157E G155K, D (15 6 15 7), A158E M149K, G155K, D (15 6 15 7), A158E N152D, G155K, D (15 6 15 7), A158E M149K, N152D, G155K, D (15 6 15 7), A158E 74 83 ... E285A K325A K327A PAI-1stab PAI-1stab(E285A) 74 91 80 59 74 51 90 57 88 18 52 63 32 88 77 75 87 10 13 33 97 82 69 76 63 99 54 42 68 59 53 70 30 57 26 67

Ngày tải lên: 20/02/2014, 11:20

9 606 0
Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

... 2 519 16 10 1 13 3 17 7 13 1 2 10 58 680 80 976 656 19 2 66 64 15 8 33 80 (52%) (66%) (60%) (45%) compared to the control area of the same nuclei (Fig lower panel) Overall, the staining intensities of ... apparatus and RNA polymerase transcription complex Science 267, 1 13 1 1 13 7 Adolph S, Brusselbach S & Muller R (19 93) Inhibition ¨ of transcription blocks cell cycle progression of NIH3T3 fibroblasts ... [10 ,14 ] Furthermore, the TFIIS holoenzyme form appears to be more abundant in the G1 ⁄ S phase of the FEBS Journal 2 73 (2006) 5 535 –5549 ª 2006 The Authors Journal compilation ª 2006 FEBS 5543...

Ngày tải lên: 07/03/2014, 11:20

15 584 0
Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefficiently donates iron to cells via nonspecific internalization and degradation of the protein pdf

Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefficiently donates iron to cells via nonspecific internalization and degradation of the protein pdf

... breakdown of the 12 5I-labelled protein and efflux of proteinfree 12 5I The release of 12 5 I-Tf and 12 5 I-sMTf from melanoma cells To examine whether sMTf could be internalized and then released from the ... concentration of  0. 01 mgÆmL )1, as we showed previously [22, 23, 26] Furthermore, unlike 12 5I-sMTf uptake, the internalized 12 5 I-Tf formed the largest proportion (60–76%) of the total uptake of this ligand, ... (MTf2) and a novel protein isoform: Explanation for the membrane-bound and soluble forms of melanotransferrin? FEBS Lett 512 , 35 0 35 2 22 Richardson, D.R & Baker, E (19 90) The uptake of iron and...

Ngày tải lên: 31/03/2014, 09:20

11 373 0
Báo cáo sinh học: " Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" pptx

Báo cáo sinh học: " Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" pptx

... participated in the design of the models proposed and in the drafting and revision of the manuscript 11 12 13 14 15 16 17 18 Astell CR, Chow MB, Ward D: Sequence analysis of the termini of virion and replicative ... cloned into the Bam HI site of pUC19 [29] [Genbank L09 13 7 ] The 3' hairpin of LuIII was obtained from pGLu8 83 [30 ], the full-length genomic clone of LuIII cloned into the pUC19 vector pGLu8 83 was digested ... 19 92, 19 0 :36 5 -37 7 All authors read and approved the final manuscript Page 10 of 11 (page number not for citation purposes) Virology Journal 2005, 2:47 19 20 21 22 23 24 25 26 27 28 29 30 31 http://www.virologyj.com/content/2 /1/ 47...

Ngày tải lên: 19/06/2014, 08:20

11 678 0
báo cáo hóa học:" Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" ppt

báo cáo hóa học:" Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" ppt

... participated in the design of the models proposed and in the drafting and revision of the manuscript 11 12 13 14 15 16 17 18 Astell CR, Chow MB, Ward D: Sequence analysis of the termini of virion and replicative ... cloned into the Bam HI site of pUC19 [29] [Genbank L09 13 7 ] The 3' hairpin of LuIII was obtained from pGLu8 83 [30 ], the full-length genomic clone of LuIII cloned into the pUC19 vector pGLu8 83 was digested ... 19 92, 19 0 :36 5 -37 7 All authors read and approved the final manuscript Page 10 of 11 (page number not for citation purposes) Virology Journal 2005, 2:47 19 20 21 22 23 24 25 26 27 28 29 30 31 http://www.virologyj.com/content/2 /1/ 47...

Ngày tải lên: 20/06/2014, 04:20

11 580 0
USE THE CORRECT FORM OF THE WORDS IN BRACKETS pdf

USE THE CORRECT FORM OF THE WORDS IN BRACKETS pdf

... came in so that she woke everyone up (noise) 12 5 12 6 12 7 12 8 12 9 13 0 13 1 13 2 13 3 13 4 13 5 13 6 13 7 10 11 12 13 14 15 16 17 Some famous directors make their films very (really) Advertising makes ... 10 7 10 8 10 9 11 0 11 1 11 2 1 13 11 4 11 5 11 6 11 7 11 8 11 9 12 0 12 1 12 2 1 23 12 4 He was because of his illness (absence) They looked at him in (astonish) She looks when she heard the news (astonish) He ... lot of interesting programmes (add) What has women’s movement resulted in? (liberate ) 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 10 0 10 1 10 2 1 03 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1...

Ngày tải lên: 21/07/2014, 21:20

6 2,7K 21
The rationale behind urban form of the javanese inland cities  urban morphology of shifting capitals of islamic mataram kingdom and its successors

The rationale behind urban form of the javanese inland cities urban morphology of shifting capitals of islamic mataram kingdom and its successors

... 10 8 Figure 33 Comparison of the size of walls of the six cities on the same scale 11 0 Figure 34 The direction of mosques compared to the correnct Qibla angle 11 1 Figure 35 The ... Table The measurements of the walls of the six cities 10 9 Table The table of angles of mosques compared to the Qibla direction 11 1 Table The size of the alun-aluns 11 4 ... 1. 1 Background 1. 1 .1 Java and the Southeast Asian City Discourse 1. 1.2 Indic relations and cosmological conceptions 1. 1 .3 The cities of Islamic Mataram...

Ngày tải lên: 16/10/2015, 15:38

177 1,2K 0
Supply the correct form of the words in brackets

Supply the correct form of the words in brackets

... the country 81 The sudden ( appear) of a security guard caused them to drop the money and run 82 Parent is( condition) upon delivery of the goods 83 The sky began to ( dark) .as the ... wear the unique and ( fashion) dresses 12 1 ( Embroidery) jeans are the 19 60s’fashion 12 2 Jeans made in China are sometimes( surprise) cheap 1 23 February is( frequency) the shortest 12 4 ... regarded as women’s work 30 Buses run( frequent) between the city and the airport 31 Don’t expect to get ( prefer) treatment 32 There was ( poem) in all her gestures 33 She introduced herself...

Ngày tải lên: 23/10/2015, 16:09

7 6,4K 25
RENORMALIZATION GROUP AND 3 3 1 MODEL WITH THE DISCRETE FLAVOUR SYMMETRIES

RENORMALIZATION GROUP AND 3 3 1 MODEL WITH THE DISCRETE FLAVOUR SYMMETRIES

... mention on the above mentioned model [4] Let us summarize the Higgs content of the model: ∼ (3, 2 /3, 3, 1 /3) , ∼ (3, 1 /3, 1, 1 /3) , ∼ (3, 2 /3, 1, 1 /3) , ∼ (3, 1 /3, 1, 2 /3) ,   + σ 13 11 12 + ++ ... [SU (3) L , U (1) X , U (1) L , S ] symmetries [5] transform as ψL l1R Q3L uR UR ≡ ∼ = ≡ ∼ 1, 2,3L =∼ [3, 1 /3, 2 /3, 3] , [1, 1, 1, 1] , lR ≡ l2,3R ∼ [1, 1, 1, 2], ∼ [3, 1 /3, 1 /3, 1] , QL ≡ Q1,2L =∼ [3 ... QL ≡ Q1,2L =∼ [3 , 0, 1 /3, 2], u1,2,3R ∼ [1, 2 /3, 0, 3] , dR ≡ d1,2,3R ∼ [1, 1 /3, 0, 3] , [1, 2 /3, 1, 1] , DR ≡ D1,2R ∼ [1, 1 /3, 1, 2], (27) (28) (29) (30 ) ( 31 ) where the subscript numbers on...

Ngày tải lên: 30/10/2015, 19:51

6 379 0
GMAT OFFICIAL GUIDE th 10 Edition 1 CRITICAL REASONING 1. Which of the following best completes

GMAT OFFICIAL GUIDE th 10 Edition 1 CRITICAL REASONING 1. Which of the following best completes

... denationalization 13 E comparing the long-term effects of the crash on the purchasing power of the currency of Country T to the immediate, more severe short-term effects of the crash on the purchasing power of ... the same way in the situation described? (E) Why are the separate parts of the self the same for all subjects? Questions 13 - 14 are based on the following 23 The program to control the entry of ... Were the users of the common land that was studied at least as prosperous as the users of the private land? (E) Were there any owners of herds who used only common land, and no private land,...

Ngày tải lên: 17/10/2013, 15:15

25 726 0
Module 1: Overview of the Microsoft .NET Platform

Module 1: Overview of the Microsoft .NET Platform

... Studio, and Win32 are either registered trademarks or trademarks of Microsoft Corporation in the U.S.A and/ or other countries The names of actual companies and products mentioned herein may be the ... trademarks of their respective owners Module 1: Overview of the Microsoft NET Platform iii Instructor Notes Presentation: 30 Minutes Lab: 00 Minutes The module starts with an overview of the Microsoft® ... Platform, and then introduces the NET Framework and services It describes the design goals and language support of the NET Framework The module concludes by providing more information about the...

Ngày tải lên: 18/10/2013, 18:15

22 449 0
Tài liệu Activity 3.1: Identifying Data-Related Use Cases and Data Requirements docx

Tài liệu Activity 3.1: Identifying Data-Related Use Cases and Data Requirements docx

... existing system at Ferguson and Bardell, Inc Using both the case study and these use cases, identify the system’s data requirements and enter them in the grid below The grid includes a few extra ... a set of current state use cases Refer to the Ferguson and Bardell, Inc case study in Appendix A of this Activity Manual Following are various use cases that capture the functionality of the existing ... Addresses of managers, administrative staff Managers correct data Customer information, time and billing information Managers approve data corrections Managerial data, time and billing information,...

Ngày tải lên: 21/12/2013, 06:16

4 390 0
Tài liệu Supply the correct form of the verbs1 docx

Tài liệu Supply the correct form of the verbs1 docx

... looking at me as if she (know) me?knew 13 If I (be) a bird, I (not,want) to live in a snake.were / wouldn't want 14 My brother managed to kill the snake just at the time when I (be) almost exhausted ... looking at me as if she (know) knew me? 13 If I (be) were a bird, I (not,want) wouldn't want to live in a snake 14 My brother managed to kill the snake just at the time when I (be) had been almost ... Why is she looking at me as if she knew me? 13 If I were a bird, I wouldn't want to live in a snake 14 My brother managed to kill the snake just at the time when I were almost exhausted If he...

Ngày tải lên: 23/01/2014, 07:20

5 1K 3
Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

... 11 1 034 11 13 1 12 020 11 438 10 539 9976 582 2702 30 –2.6 (2.67–2.60) 24.7 (30 .1) 30 .7 (32 .0) 29 0. 016 5 63 2706 30 –2.7 (2.77–2.70) 22.8 ( 31 .7) 27.2 ( 31 .4) 29 0. 014 1. 7 1. 6 GGGCTGATGGTGGCCGTCACCGCGCAC; H121A3–5, ... E 13 8 A:dTTP P 632 2 1. 046 50–2.6 (2.74–2.6) 13 . 5 ( 51. 5) 21. 9 (2.6) 92.7 (70.0) 12 .2 (5.5) 14 719 8 12 085 H121A:dCTP P 632 2 1. 046 50–2.7 (2.85–2.7) 12 .3 (47.2) 4.9 (1 .3) 94.2 (75 .1) 10 .0 (5.4) 11 1 034 ... the crystallographic analysis of the wild-type:dTTP described Therefore, the lack of activity of H121A and the structural similarity between the H121A:dCTP and the E 13 8 A:dTTP complexes (Fig 2E)...

Ngày tải lên: 18/02/2014, 16:20

11 577 0
RELEASE NOTES FOR VERSION 1.0 OF THE DATABASE pdf

RELEASE NOTES FOR VERSION 1.0 OF THE DATABASE pdf

... which is the array of weights used to combine the pixels from the long and the short image In the case of these combined images the error (ERR) array contains the standard deviations of the weighted ... intentionally overexpose the core of the Balmer lines from the central star in the long exposure in order to obtain greater signal in the wings of the lines and the fainter parts of the surrounding nebula ... source The above plot is of three extractions from a spectrum of BD +75 32 5 which are 0 .1 wide centered 0 .1 off the peak of the PSF The bottom extraction was made from data reduced by the STScI...

Ngày tải lên: 07/03/2014, 14:20

6 425 0
Báo cáo khoa học: Crystal structure of the soluble form of the redox-regulated chloride ion channel protein CLIC4 doc

Báo cáo khoa học: Crystal structure of the soluble form of the redox-regulated chloride ion channel protein CLIC4 doc

... REFMAC V [35 ] b From PROCHECK 11 6 7 91 (25 13 7 ) 99.9% (99.9%) 8.4 (1 .3) 0.0 63 (0.58) ˚ 27.6 A2 18 84 (15 8) 0 .19 5 (0.28) 0. 2 31 (0 .33 ) ˚ 0. 016 A 1. 46° 93. 5% 6.0% 0.5% (Asp87) 0% [38 ] ˚ dimensions of 50 ... structure of the soluble form of CLIC4 the backbone and side chain of Asn34 and the side chain of Lys24 This crystal contact stabilizes the structure of the leading side of the foot loop The putative ... (2000) CLIC -1 functions as a chloride channel when FEBS Journal 272 (2005) 4996–5007 ª 2005 FEBS Crystal structure of the soluble form of CLIC4 28 29 30 31 32 33 34 35 36 37 38 expressed and purified...

Ngày tải lên: 23/03/2014, 15:21

12 288 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... pHPI -15 07 pHPI -15 07 kDa 24 17 pHPI -14 94 kDa Control MG 13 2 Lactacystin DMSO MG 13 2 pHPI -15 07 pHPI -14 94 Control pHPI -14 95 MG 13 2 pHPI -14 95 (a) B 20 14 pHPI -15 79 +MG 13 2 pHPI -15 79 pHPI -14 96 +MG 13 2 ... core nts 34 2- 514 (a) CMV nt 825 myc( +1) nt 34 5 pHPI -15 07 nt 825 core +1 nt 515 nt 825 myc( +1) core +1 (b) nt 515 core +1/ S–myc pHPI -14 94 myc( +1) core CMV pHPI -14 95 nt 825 core +1 myc ( +1) pHPI -14 96 myc ... 22 13 22 13 22 13 13 Expected size (kDa) – – – – + (by )1 ⁄ +2 f at core codons 8 11 ) – + – – + Core coexpression N Vassilaki et al Expression of the HCV -1 core +1 protein 4069 Expression of the...

Ngày tải lên: 30/03/2014, 03:20

18 365 0
w