3 1 form of the field equations

Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

... variants: Noxo1b (AB097667, AF 532 984, and AF 539 796), Noxo1c (AF 532 985), Noxo1a (AY255768 and AF 532 9 83) , and Noxo1d (AY19 13 5 9) On the basis of the sequence of splice variants, we synthesized the full-length ... 269, 13 1 14 0 33 Harper RW, Xu C, Soucek K, Setiadi H & Eiserich JP (2005) A reappraisal of the genomic organization of human Nox1 and its splice variants Arch Biochem Biophys 435 , 32 3 33 0 34 Arbiser ... interaction of their SH3 domains with p22phox [25– 27] Although the SH3 domain of Noxo1 participates in regulation of Nox3, the role of the PX domain in Nox3 activity remains unknown In the process of...

Ngày tải lên: 19/02/2014, 06:20

15 633 0
Báo cáo y học: "Inhibition of HIV-1 replication by P-TEFb inhibitors DRB, seliciclib and flavopiridol correlates with release of free P-TEFb from the large, inactive form of the complex" potx

Báo cáo y học: "Inhibition of HIV-1 replication by P-TEFb inhibitors DRB, seliciclib and flavopiridol correlates with release of free P-TEFb from the large, inactive form of the complex" potx

... replication J Biol Chem 2000, 275 (37 ):2 834 5-2 834 8 Page 11 of 12 (page number not for citation purposes) Retrovirology 2007, 4:47 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Mancebo HS, Lee G, ... (HEXIM1) [ 13 , 14 ] or HEXIM2 [15 ] In HeLa cells, between 50% and 90% of P-TEFb is present in the large form of the complex while the remainder of P-TEFb is in the kinase active, free form [9 ,10 ,14 ,15 ] ... together at the end of the experiment The average IC50 for inhibition of viral replication in the presence of flavopiridol for donor #1 was 35 nM and the LD50 was 1 43 nM, yielding a T.I of 4.1...

Ngày tải lên: 13/08/2014, 05:22

12 477 0
GMAT OFFICIAL GUIDE th 10 Edition 1 CRITICAL REASONING 1. Which of the following best completes

GMAT OFFICIAL GUIDE th 10 Edition 1 CRITICAL REASONING 1. Which of the following best completes

... denationalization 13 E comparing the long-term effects of the crash on the purchasing power of the currency of Country T to the immediate, more severe short-term effects of the crash on the purchasing power of ... the same way in the situation described? (E) Why are the separate parts of the self the same for all subjects? Questions 13 - 14 are based on the following 23 The program to control the entry of ... approximately the same level between 19 80 and 19 84 E Prior to 19 80 another species of insect pollinated the Asian palm trees, but not as efficiently as the species of weevil that was introduced in 19 80 41...

Ngày tải lên: 17/10/2013, 15:15

25 726 0
Module 1: Overview of the Microsoft .NET Platform

Module 1: Overview of the Microsoft .NET Platform

... trademarks of their respective owners Module 1: Overview of the Microsoft NET Platform iii Instructor Notes Presentation: 30 Minutes Lab: 00 Minutes The module starts with an overview of the Microsoft® ... List the main elements of the NET Platform Describe the NET Framework and its components Explain the language support in the NET Framework 2 Module 1: Overview of the Microsoft NET Platform ... need the following materials: Microsoft PowerPoint® file 212 4C_ 01. ppt Module 1, “Overview of the Microsoft NET Platform” Preparation Tasks To prepare for this module, you should: Read all of the...

Ngày tải lên: 18/10/2013, 18:15

22 449 0
Tài liệu Supply the correct form of the verbs1 docx

Tài liệu Supply the correct form of the verbs1 docx

... looking at me as if she (know) me?knew 13 If I (be) a bird, I (not,want) to live in a snake.were / wouldn't want 14 My brother managed to kill the snake just at the time when I (be) almost exhausted ... looking at me as if she (know) knew me? 13 If I (be) were a bird, I (not,want) wouldn't want to live in a snake 14 My brother managed to kill the snake just at the time when I (be) had been almost ... Why is she looking at me as if she knew me? 13 If I were a bird, I wouldn't want to live in a snake 14 My brother managed to kill the snake just at the time when I were almost exhausted If he...

Ngày tải lên: 23/01/2014, 07:20

5 1K 3
Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

... 11 1 034 11 13 1 12 020 11 438 10 539 9976 582 2702 30 –2.6 (2.67–2.60) 24.7 (30 .1) 30 .7 (32 .0) 29 0. 016 5 63 2706 30 –2.7 (2.77–2.70) 22.8 ( 31 .7) 27.2 ( 31 .4) 29 0. 014 1. 7 1. 6 GGGCTGATGGTGGCCGTCACCGCGCAC; H121A3–5, ... E 13 8 A:dTTP P 632 2 1. 046 50–2.6 (2.74–2.6) 13 . 5 ( 51. 5) 21. 9 (2.6) 92.7 (70.0) 12 .2 (5.5) 14 719 8 12 085 H121A:dCTP P 632 2 1. 046 50–2.7 (2.85–2.7) 12 .3 (47.2) 4.9 (1 .3) 94.2 (75 .1) 10 .0 (5.4) 11 1 034 ... binding of FEBS Journal 274 (2007) 418 8– 419 8 ª 2007 The Authors Journal compilation ª 2007 FEBS E Johansson et al 10 11 12 13 14 15 16 17 donkey deoxycytidylate aminohydrolase (EC 3. 5.4 .12 ) Arch...

Ngày tải lên: 18/02/2014, 16:20

11 577 0
RELEASE NOTES FOR VERSION 1.0 OF THE DATABASE pdf

RELEASE NOTES FOR VERSION 1.0 OF THE DATABASE pdf

... which is the array of weights used to combine the pixels from the long and the short image In the case of these combined images the error (ERR) array contains the standard deviations of the weighted ... intentionally overexpose the core of the Balmer lines from the central star in the long exposure in order to obtain greater signal in the wings of the lines and the fainter parts of the surrounding nebula ... extractions from a spectrum of BD +75 32 5 which are 0 .1 wide centered 0 .1 off the peak of the PSF The bottom extraction was made from data reduced by the STScI pipeline (green) The middle extraction...

Ngày tải lên: 07/03/2014, 14:20

6 425 0
Báo cáo khoa học: Crystal structure of the soluble form of the redox-regulated chloride ion channel protein CLIC4 doc

Báo cáo khoa học: Crystal structure of the soluble form of the redox-regulated chloride ion channel protein CLIC4 doc

... PROCHECK 11 6 7 91 (25 13 7 ) 99.9% (99.9%) 8.4 (1 .3) 0.0 63 (0.58) ˚ 27.6 A2 18 84 (15 8) 0 .19 5 (0.28) 0. 2 31 (0 .33 ) ˚ 0. 016 A 1. 46° 93. 5% 6.0% 0.5% (Asp87) 0% [38 ] ˚ dimensions of 50 · 40 · 20 A3 CLIC4 ... Crystal structure of the soluble form of CLIC4 28 29 30 31 32 33 34 35 36 37 38 expressed and purified from bacteria J Biol Chem 275, 26986–269 93 Warton K, Tonini R, Fairlie WD, Matthews JM, Valenzuela ... refmac v [35 ]) The final model consists of residues 16 1 63 and 1 73 257 plus 15 8 water molecules Residues Pro76 and Pro102 have cis peptide bonds The final R-factor is 0 .19 5, with Rfree 0. 2 31 (Rfree...

Ngày tải lên: 23/03/2014, 15:21

12 288 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... pHPI -15 07 pHPI -15 07 kDa 24 17 pHPI -14 94 kDa Control MG 13 2 Lactacystin DMSO MG 13 2 pHPI -15 07 pHPI -14 94 Control pHPI -14 95 MG 13 2 pHPI -14 95 (a) B 20 14 pHPI -15 79 +MG 13 2 pHPI -15 79 pHPI -14 96 +MG 13 2 ... core nts 34 2- 514 (a) CMV nt 825 myc( +1) nt 34 5 pHPI -15 07 nt 825 core +1 nt 515 nt 825 myc( +1) core +1 (b) nt 515 core +1/ S–myc pHPI -14 94 myc( +1) core CMV pHPI -14 95 nt 825 core +1 myc ( +1) pHPI -14 96 myc ... 22 13 22 13 22 13 13 Expected size (kDa) – – – – + (by )1 ⁄ +2 f at core codons 8 11 ) – + – – + Core coexpression N Vassilaki et al Expression of the HCV -1 core +1 protein 4069 Expression of the...

Ngày tải lên: 30/03/2014, 03:20

18 365 0
Báo cáo khoa học: Mapping the binding domains of the aIIb subunit A study performed on the activated form of the platelet integrin aIIbb3 pot

Báo cáo khoa học: Mapping the binding domains of the aIIb subunit A study performed on the activated form of the platelet integrin aIIbb3 pot

... aIIb 294 31 4a aIIb 31 3 33 2 aIIb 469–488 RGDS 56 23 34 51 800 2844 2 510 30 0 7490 210 39 10 11 22 530 211 6 17 62 13 0 4288 1 13 0 0 0 78.0 ± 6.0b a For details, see the Results b Values represent the mean ... of W1, (b) aIIb 265–284 comprises strands and of W4, including the loops (2 73 274) and (2 83 285) and (c) aIIb 31 3 33 2 incorporates strands ( 31 3 31 8) and ( 31 9 33 2) of W5, enclosing the loop ( 31 3 32 3) ... close vicinity of the 31 3 32 3 domain Thus, it is possible that the binding of this antibody to residues 33 5 33 8 could influence the interaction between 31 3 32 3 and fibrinogen Furthermore, the region...

Ngày tải lên: 31/03/2014, 07:20

8 499 0
Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefficiently donates iron to cells via nonspecific internalization and degradation of the protein pdf

Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefficiently donates iron to cells via nonspecific internalization and degradation of the protein pdf

... incubated for 30 to 30 h at 37 °C or h at °C with 59Fe -12 5I-Tf (0.0 01 0 .1 mgÆmL )1) or 59Fe -12 5IsMTf (0.0 01 0 .1 mgÆmL )1) in MEM containing BSA (10 mgÆmL )1) The cells were then placed on a tray of ice ... Physiol 246, G26–G 33 33 Thorstensen, K., Trinder, D., Zak, O & Aisen, P (19 95) Uptake of iron from N-terminal half-transferrin by isolated rat Ó FEBS 2002 34 35 36 37 38 39 40 41 42 43 Soluble melanotransferrin ... Physiol 16 1, 16 0 16 8 24 Richardson, D & Baker, E (19 91) The uptake of inorganic iron complexes by human melanoma cells Biochim Biophys Acta 10 93, 20–28 25 Richardson, D.R & Baker, E (19 91) The release...

Ngày tải lên: 31/03/2014, 09:20

11 373 0
time machine 1 secret of the knights

time machine 1 secret of the knights

... to the stump of the mast and chop at the tangle of ropes until the mast is free The small foresail at the bow of the ship rips to shreds and blows away Now the ship spins with its side to the ... God!” People drop to their knees and pray to the statue of Our Lady of the Conception, bolted to the deck Another mountain of water hits the ship When it clears, the statue of the saint is gone ... of men waving pistols approach the shore The people of Vera Cruz grab what they can carry from their houses and 20 run for the hills A cannonball hits the tower of the old white church, and the...

Ngày tải lên: 31/05/2014, 01:29

130 447 0
Báo cáo sinh học: " Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" pptx

Báo cáo sinh học: " Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" pptx

... and in the drafting and revision of the manuscript 11 12 13 14 15 16 17 18 Astell CR, Chow MB, Ward D: Sequence analysis of the termini of virion and replicative forms of Minute Virus of Mice ... cloned into the Bam HI site of pUC19 [29] [Genbank L09 13 7 ] The 3' hairpin of LuIII was obtained from pGLu8 83 [30 ], the full-length genomic clone of LuIII cloned into the pUC19 vector pGLu8 83 was digested ... duplex copy of the original 3' palindrome [8 ,10 ,12 , 13 ] In the bridge arrangement of the dRF, the mismatched doublet GA and triplet GAA are now based paired to their complementary sequences The sequence...

Ngày tải lên: 19/06/2014, 08:20

11 678 0
báo cáo hóa học:" Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" ppt

báo cáo hóa học:" Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus" ppt

... and in the drafting and revision of the manuscript 11 12 13 14 15 16 17 18 Astell CR, Chow MB, Ward D: Sequence analysis of the termini of virion and replicative forms of Minute Virus of Mice ... cloned into the Bam HI site of pUC19 [29] [Genbank L09 13 7 ] The 3' hairpin of LuIII was obtained from pGLu8 83 [30 ], the full-length genomic clone of LuIII cloned into the pUC19 vector pGLu8 83 was digested ... duplex copy of the original 3' palindrome [8 ,10 ,12 , 13 ] In the bridge arrangement of the dRF, the mismatched doublet GA and triplet GAA are now based paired to their complementary sequences The sequence...

Ngày tải lên: 20/06/2014, 04:20

11 580 0
USE THE CORRECT FORM OF THE WORDS IN BRACKETS pdf

USE THE CORRECT FORM OF THE WORDS IN BRACKETS pdf

... came in so that she woke everyone up (noise) 12 5 12 6 12 7 12 8 12 9 13 0 13 1 13 2 13 3 13 4 13 5 13 6 13 7 10 11 12 13 14 15 16 17 Some famous directors make their films very (really) Advertising makes ... 10 7 10 8 10 9 11 0 11 1 11 2 1 13 11 4 11 5 11 6 11 7 11 8 11 9 12 0 12 1 12 2 1 23 12 4 He was because of his illness (absence) They looked at him in (astonish) She looks when she heard the news (astonish) He ... lot of interesting programmes (add) What has women’s movement resulted in? (liberate ) 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 10 0 10 1 10 2 1 03 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1...

Ngày tải lên: 21/07/2014, 21:20

6 2,7K 21
Chapter 3 - General Principles of the IMS Architecture pot

Chapter 3 - General Principles of the IMS Architecture pot

... OF THE IMS ARCHITECTURE 46 The SIM application was standardized in the early stages of GSM 3GPP inherited the specifications (currently SIM is specified in 3GPP TS 11 .11 [ 21] and 3GPP TS 51. 011 ... resides in an IBCF; see Section 3. 7.2.) Figure 3. 3: The IMS-ALG and the TrGW Figure 3. 3 shows the relation of the IMS-ALG with the TrGW and the rest of the IMS nodes The IMS-ALG acts as a SIP B2BUA ... identity of the user to the rest of the nodes in the network This way, other nodes not need to further authenticate the user, because they trust the P-CSCF The rest of the nodes in the network use this...

Ngày tải lên: 01/08/2014, 17:21

30 442 0
Báo cáo y học: "Association of the microsatellite in the 3'''' untranslated region of the CD154 gene with rheumatoid arthritis in females from a Spanish cohort: a case-control study" ppsx

Báo cáo y học: "Association of the microsatellite in the 3'''' untranslated region of the CD154 gene with rheumatoid arthritis in females from a Spanish cohort: a case-control study" ppsx

... 24CAs (n = 13 ) Non-24CAs (n = 15 ) P CD16/CD56a 16 .07 ± 10 .78 12 .38 ± 10 .24 n.s CD19a 6.42 ± 3. 12 4 .17 ± 3. 01 0. 018 CD3/CD8a 17 .24 ± 7.66 22 .37 ± 6.67 n.s CD3/CD4a 44.40 ± 14 .79 41. 22 ± 13 . 11 n.s CD4/CD69b ... Rheum Dis Clin North Am 2002, 28 :17 -37 Page of 11 (page number not for citation purposes) Arthritis Research & Therapy 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Vol No Martin-Donaire et al ... 13 . 11 n.s CD4/CD69b 14 .09 ± 19 .02 7.48 ± 10 .25 n.s CD4/CD25b 59.59 ± 18 .04 41. 19 ± 22.84 0. 036 CD4/CD154b 4.28 ± 3. 81 8 .12 ± 5. 73 0. 033 Results are means ± SD for cells expressing the indicated surface...

Ngày tải lên: 09/08/2014, 10:21

11 455 0
Báo cáo y học: " Generation of H9 T-cells stably expressing a membrane-bound form of the cytoplasmic tail of the " pps

Báo cáo y học: " Generation of H9 T-cells stably expressing a membrane-bound form of the cytoplasmic tail of the " pps

... Retrovirology 2006, 3: 27 10 11 12 13 14 15 16 17 http://www.retrovirology.com/content /3/ 1/ 27 pp60v-src and pp60c-src molecules J Cell Biol 19 85, 10 0:409- 417 Morrison D: 14 -3- 3: modulators of signaling ... (Fig 1C, right panels) Reprobing the blot with antibodies to the 30 kDa cytosolic protein 14 -3- 3 γ (C -16 ) [10 ] confirmed the authenticity of the membrane/cytosol separation In summary, these ... lysates of pNL-Wt infected cells and truncated gp160 (gp140) and gp120 in lysates of pNL-Tr 712 infected cells The truncated gp 41 species (gp28) expressed by pNL-Tr 712 was not detected since the antibodies...

Ngày tải lên: 13/08/2014, 09:21

5 362 0
information systems - the state of the field

information systems - the state of the field

... Galliers 32 4 17 Cleaning the Mirror: Desperately Seeking Identity in the Information Systems Field Daniel Robey 33 2 18 Designing Design Science—Salvatore T March 33 8 19 The Future of the IS Field: ... 13 Like Ships Passing in the Night: The Debate on the Core of the Information Systems Discipline— Ron Weber 2 93 14 Further Reflections on the Identity Crisis—Izak Benbasat and Robert W Zmud 30 0 ... honest to subtitle the book, The States of the Field , but that seemed like overreaching, even for the editors The plurality of the IS field is a central theme in much of the commentary in this...

Ngày tải lên: 18/10/2014, 20:24

389 924 0
w