3  sign an air file with a trusted certificate

... find another tap and having to use a long hose which may, anyway, not fit the shape of some taps Simpler than playing around with washing machine hoses Procedure: 1)Squeeze the single mixer tap ... non-mains pressured COLD supply i.e also fed from a header tank and which also has an airlock: Same as just described but this time you need to use the mains pressured water to purge the non-mains ... supply, is probably inaccessible from downstairs and therefore nowhere near any mains pressured water To this you firstly need to create a path between the hot water supply and the non-mains pressured...

Ngày tải lên: 17/12/2013, 10:45

... Saksena Sumeet Saksena is a Fellow in the Research Program at the East-West Center He is also Affiliate Faculty at the Department of Urban And Regional Planning, University of Hawai`i at Manoa ... water, land, and plants and animals – as well as buildings, streets, and the like.” The researchers concluded that environmental quality is no longer seen as a post-materialist value and that ... demographic background, between human perception of visual air quality and physical indicators such as color and contrast in a landscape Flachsbart and Phillips (1980) used physical data for a variety...

Ngày tải lên: 06/03/2014, 16:20

... 19-NA at various concentrations, the conductance of Art KSI/mA51-labeled SiNW-FET rapidly increased to a constant value [Fig 5(b)] 19-NA at a greater concentration resulted in a greater conductance, ... novel nano-bio-device can attain a femtomolar level Acknowledgements National Science Council and the MOE-ATU Program in Taiwan provided financial support References [1] B.G England, G.H Parsons, ... Chang et al / Sensors and Actuators B 138 (2009) 148–153 149 with HF solution After defining the contact pad patterns, a stack of Ti (10 nm) and Au (100 nm) was then evaporated with a thermal...

Ngày tải lên: 16/03/2014, 15:23

... Mts (altitude 900–1,050 m) with mean annual temperature 4–4.5°C and total annual precipitation 1,050–1,200 mm, growing season 100–115 days and natural species composition P abies, F sylvatica and ... growing season 115–130 days and natural species composition Fagus sylvatica L., Abies alba Mill and Picea abies (L.) Karst Fageto-Piceetum acidophilum (7K) is a typical site of upland locations ... by ameliorative liming, calcium occurred in optimum and with higher content At the balanced catch of earthworms (abundance 63.7 and 67.3 individuals·m–2), the abundance of D attemsi was clearly...

Ngày tải lên: 07/08/2014, 10:21

... Rahman S, Almutawa A ASB, Al-Bedah AM, Al-Rabeah AM, Ali Bahaj A, El-Awa F, CW JN, Asma S: Prevalence of tobacco use among students aged 13-15 years in Health Ministers’ Council/Gulf Cooperation ... 20 Nafae A, Misra SP, Dhar SN, Shah SN: Bronchogenic carcinoma in Kashmir Valley Indian J Chest Dis 1973, 15(4):285-295 21 Gunaid AA, Sumairi AA, Shidrawi RG, al-Hanaki A, al-Haimi M, al-Absi ... Dar-Odeh NS, Bakri FG, Al-Omiri MK, Al-Mashni HM, Eimar HA, Khraisat AS, Abu-Hammad SM, Dudeen AA, Abdallah MN, Alkilani SM, Al-Shami L, AbuHammad OA: Narghile (water pipe) smoking among university...

Ngày tải lên: 11/08/2014, 18:20

... efficiency against both antibiotic-susceptible and antibiotic-resistant bacterial strains Killing of bacteria by fowlicidins starts immediately on contact with bacteria, in sharp contrast with human cathelicidin ... hydrophobicity, and helicity are among the most important factors that influence the antibacterial and toxicity of a- helical cationic peptides [23,24], rational changes of these structural and physicochemical ... Gram-positive bacteria (Listeria monocytogenes ATCC 19115, Staph aureus ATCC 25923, Staph aureus ATCC BAA-39, and Staph aureus ATCC 43300) were purchased from either ATCC (Manassas, VA, USA) or MicroBiologics...

Ngày tải lên: 07/03/2014, 11:20

... log-rank test A P value < 0.05 was considered statistically significant RESULTS Baseline clinical, coronary angiographic and lesion characteristics are shown in Table and Table No significant ... Turkish patients Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; ... the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety and efficacy of Paclitaxel-eluting...

Ngày tải lên: 25/10/2012, 11:18

... received the PES Baseline angiographic characteristics were also similar according to the modified ACC/AHA (American College of Cardiology/American Heart Association) classification.22 Overall, most ... 001 04 307 Abbreviations: CABG, Coronary artery bypass graft; MACE, Major adverse cardiac event (ie, death, myocardial infarction, and target vessel revascularization a Indicates patients who ... Turkish patients Acknowledgments All support for this study came from institutional and departmental resources Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG:...

Ngày tải lên: 26/10/2012, 08:57

... Vietnames e Maths Science Informatics 1.Look, listen and repeat Nam: Do you have Maths today? Mai: No, I dont Nam: What subjects you have? Mai: I have Vietnamese and English Model sentences: What subjects ... and repeat Listen and repeat Let s talk 2.Look and say Lets talk Listen and repeat Lets talk Friday,November12 th 2010 UNIT : MY SCHOOL SUBJECTS NEWWORDS SECTION A 1,2,3 -subject :mụn hc -have :hc ... -Maths :mụn toỏn -Science :mụn khoa hc -Informatics :mụn tin hc -Art :mụn M thut -English :mụn ting Anh -Vietnamese :mụn ting vit CHECK NEWWORDS: *WHAT AND WHERE* Subject English Art Vietnames...

Ngày tải lên: 03/12/2013, 04:11

... Vietnames e Maths Science Informatics 1.Look, listen and repeat Nam: Do you have Maths today? Mai: No, I dont Nam: What subjects you have? Mai: I have Vietnamese and English Model sentences: What subjects ... and repeat Listen and repeat Let s talk 2.Look and say Lets talk Listen and repeat Lets talk Friday,November12 th 2010 UNIT : MY SCHOOL SUBJECTS NEWWORDS SECTION A 1,2,3 -subject :mụn hc -have :hc ... -Maths :mụn toỏn -Science :mụn khoa hc -Informatics :mụn tin hc -Art :mụn M thut -English :mụn ting Anh -Vietnamese :mụn ting vit CHECK NEWWORDS: *WHAT AND WHERE* Subject English Art Vietnames...

Ngày tải lên: 03/12/2013, 04:11

... Here are descriptions of the three DiffGram sections: The DataInstanceName is the name of the DataSet or DataTable This block contains the current version of the data containing ... the section Elements in this section are matched to elements in the section using the diffgr:id annotation with matching values The example loads all Categories ... original and current values for the contents of a DataSet It does not include any schema information The DiffGram is also the primary serialization format used by the NET Framework to persist and...

Ngày tải lên: 21/01/2014, 11:20

... carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic activities, and they regulate each others activity ... RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR...

Ngày tải lên: 18/02/2014, 08:20

... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... Isolation and chemical identication of trypsinogen from human brain Different antihuman trypsinogen mAbs were raised separately against recombinant human trypsin (mAb B1, mAb B7) and the 28-amino...

Ngày tải lên: 07/03/2014, 10:20

... the transmembrane region of APP, and has the typical amino acid composition of transmembrane helices, i.e small (Gly and Ala) and hydrophobic (Ile, Leu, Met and Val) residues [36] The only charged ... with the routine CALIBA of the program package DYANA [29] After discarding redundant and duplicated constraints, the final list included 130 intraresidue and 283 interresidue (149 sequential and ... concentration and temperature conditions Several organic solvents and mixtures of organic solvents with water, such as trifluoroethanol, trifluoroethanol/H2O, hexafluoroacetone hydrate, hexafluoroacetone...

Ngày tải lên: 08/03/2014, 09:20

... km) plane, in December, January and February (solid lines) and in June, July and August (dashed lines) of (a) the North America tracer at W between 36 N and 70 N, and (b) the Asia tracer at 125 ... highway Air pollution transport in an intercontinental express highway across the North Atlantic can take as little as one day The time from the emission of an air pollutant at the surface in ... from Newfoundland across the Atlantic almost to Scandinavia According to FLEXPART, the leading tip of the NOx tracer lament had travelled from south of Greenland to Scandinavia, more than 50 of longitude...

Ngày tải lên: 15/03/2014, 20:20

... in green algae and vascular plants, i.e the green lineage of plants ClpP genes are also found in Cyanobacteria [22] and in the genome of the Cyanophora cyanelle, an ancestral chloroplast In the ... ClpP1 antibody The ClpP1H and ClpP1L bands decrease slowly and concomitantly after 24 h, indicating that both are stable in the cell As a loading control, a duplicate blot was reacted with an antibody ... Institute and the Chlamydomonas Genome Project for EST data and ´ cDNA material, and H Moreau (Observatoire Oceanologique de Banyuls, France) for granting us access to the Ostreococcus blast analysis...

Ngày tải lên: 16/03/2014, 23:20

... detected with the molybdate reagent, reducing sugars, with aniline hydrogenphthalate; and ribitol and monosaccharides, with 5% (w/v) AgNO3 in aqueous ammonia Acid hydrolysis was carried out with ... contained two abundant signals at d4.90 (J1,2 < Hz) and 5.07 (J1,2 3.6 Hz) and two signals of lower intensities at d4.55 (J1,2 7.9 Hz) and 4.66 (J1,2 7.9 Hz) (Table 2) Two signals at d1.93 and ... Cell wall anionic polymers and peptidoglycan of Actinoplanes philippinensis VKM Ac-647 Arch Microbiol 154, 483–488 17 Tul’skaya, E.M., Vylegzhanina, K.S., Streshinskaya, G.M., Shashkov, A. S & Naumova,...

Ngày tải lên: 17/03/2014, 10:20

... resonance of 4,4-dimethyl-4-silapentane-1-sulfonic acid used as an internal standard Distance restraints and structure calculations An initial survey of distance constraints was performed on a series ... zation of a novel conus peptide with apparent antinociceptive activity J Biol Chem 275, 32391–32397 18 Sharpe IA, Gehrmann J, Loughnan ML, Thomas L, Adams DA, Atkins A, Palant E, Craik DJ, Adams DJ, ... outcome was a set of 20 ˚ structures with a mean global rmsd of 0.56 ± 0.16 A and a ˚ mean global heavy atom rmsd of 1.30 ± 0.28 A Structural refinement was carried out using amber and structure quality...

Ngày tải lên: 30/03/2014, 09:20

... This Zeeman pair was probably overlooked by the authors, or dismissed as showing too large a velocity separation d From EVN data are really new as they are related to the flare which took place between ... maser features and the simultaneous dimming of nearby features can be interpreted as originating from the passage of a magnetohydrodynamic (MHD) shock (Alakoz et al 2005) The shock was probably ... close to VLA2, at a distance of 55 mas (±40 mas), or at the projected distance of 110 AU (±80 AU) Therefore, the OH masers may well be located in the same shell as the water masers The magnetic...

Ngày tải lên: 28/04/2014, 13:15

... by epitaxial mismatch with a substrate, will change phosphorene from a direct-gap to an indirect-gap semiconductor with a significantly smaller gap Details of the computational approach are listed ... transfer curves for drain bias values Vds = 0.01 and 0.5 V, which indicate a current on/ off ratio of ∼104, a very reasonable value for a material with a bulk band gap of 0.3 eV We also note that, ... Interest: The authors declare no competing financial interest 4040 2014 www.acsnano.org ARTICLE 36 Fang, H.; Chuang, S.; Chang, T C.; Takei, K.; Takahashi, T.; Javey, A High-Performance Single Layered...

Ngày tải lên: 06/05/2014, 08:54