3  display text in a graphic element

iec 60076-3 power transformers - insulation levels, dielectric tests and external clearances in a

iec 60076-3 power transformers - insulation levels, dielectric tests and external clearances in a

... Standardandthecorrespondingnational indicated in the latter national regional and standards or regionalstandardshall Any beclearly 5) TheIECprovidesnomarkingproceduretoindicate its approvalandcannotberenderedresponsibleforany ... separate source AC withstand voltage according to table 2, or 4; - if applicable in table 1, a standard short-duration AC induced withstand voltage (ACSD) for the line terminals according to table2, ... participateinthispreparatorywork.International,governmentalandnon-governmentalorganizationsliaising with the IEC also participate in this preparation TheIEC collaborates closely with the International Organization...

Ngày tải lên: 25/12/2013, 10:34

125 632 9
Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc

Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc

... minimal surfaces with small interior boundaries are graphical away from the boundary Here small means contained in a small ball 527 PLANAR DOMAINS A “pair of pants” (in bold) Graphical annuli (dotted) ... surfaces with small interior boundaries are graphical away from the boundary Here small means contained in a small ball in R3 (and not that the interior boundary has small length) 534 TOBIAS ... Solving a Plateau problem gives a stable graphical annulus separating the boundary components of an embedded minimal annulus Stability of Γ in Theorem 0.3 is used in two ways: To get a pointwise...

Ngày tải lên: 14/02/2014, 17:20

51 463 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with a rabbit antiserum directed against recombinant C reinhardtii CP12 (1 : 2000) or a rabbit antiserum directed against recombinant C reinhardtii GAPDH (1 : 5000) Antibody binding was revealed...

Ngày tải lên: 19/02/2014, 16:20

8 494 0
Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx

Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx

... the fact that occasionally, the exact location of an insertion of text cannot be determined completely accurately I found that by disregarding a very small region around each instance of an insertion ... 1988] as a final stage of the processing This will obtain the high accuracy of the computationally intensive algorithm while maintaining the benefits of the efficient length-based approach In addition ... in order To augment it, more information is considered The actual score for deciding that two paragraphs are matched also takes into consideration a sequence of paragraphs immediately preceding...

Ngày tải lên: 22/02/2014, 10:20

5 456 0
Báo cáo khoa học: "Multilingual Text Processing in a Two-Byte Code" pdf

Báo cáo khoa học: "Multilingual Text Processing in a Two-Byte Code" pdf

... identically with transliteration-equivalence for each of the alphabets of India A printer with only Tamil letters can simply ~ i n t a Tamil transliteration of an incoming Hindl message AEKNONLE~TS ... expansion Applications to transliteration and llh~ar~ processing Wlth newer capabilities of printers and screens, a speaker of any language can soon r e q u e s t a data b a s e i n its m~iginsl ... represent a single functional unit, but occasionally we see exceptions, an in Dutch where the ~ digraph appears an a ligature on a single key and is printed in one Table I f ~ ~ Some Consonant Characters...

Ngày tải lên: 08/03/2014, 18:20

4 322 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

... together along an axis GRAPHICAL OFF THE AXIS 31 BR A B C Figure 4: Proving Theorem 0.2 A Finding a small N -valued graph in Σ B Extending it in Σ to a large N -valued graph C Extending the number ... result from [CM4] asserting that an embedded minimal disk with large curvature at a point contains a small, almost flat, multi-valued graph nearby Namely, we prove in [CM4] the following theorem: Theorem ... separation w = π A multi-valued minimal graph is a multi-valued graph of a function u satisfying the minimal surface equation GRAPHICAL OFF THE AXIS 29 x3 -axis One half rotation Figure 2: The...

Ngày tải lên: 14/03/2014, 22:20

43 410 0
Báo cáo khoa học: "Automatic Editing in a Back-End Speech-to-Text System" doc

Báo cáo khoa học: "Automatic Editing in a Back-End Speech-to-Text System" doc

... pedal edema bilaterally neurological exam is nonfocal doctors name dictating a progress note on first name last name patient without complaints has been ambulating without problems no chest pain ... experiments have used a separate autopunctuation step, future work will aim to eliminate it by integrating the punctuation features into the transformation step In the future we plan to integrate additional ... conforming to the customary standards We need to look for what the user wants rather than what he says Natural language processing research has addressed a number of these issues as individual problems:...

Ngày tải lên: 17/03/2014, 02:20

7 363 0
Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

... FabD, FabH_2, FabB_3, and AccACD In this cycle, acetyl-CoA is carboxylated (driven by ATP hydrolysis) and decarboxylated again (Fig 2) The remaining EFMs are capable of producing all of the main ... that E coli has a very complex metabolism An earlier metabolic pathway analysis of amino acid metabolism in E coli was also indicative of high redundancy [49] For analysis of robustness, rather ... A- producing elementary modes Table S2 Lipid A (cold-adapted)-producing elementary modes Table S3 Cardiolipin-producing elementary modes Table S4 L1-phosphatidylethanolamine-producing elementary modes...

Ngày tải lên: 22/03/2014, 21:20

12 554 0
Báo cáo khoa học: N-Glycan structures of squid rhodopsin Existence of the a1–3 and a1–6 difucosylated innermost GlcNAc residue in a molluscan glycoprotein pot

Báo cáo khoa học: N-Glycan structures of squid rhodopsin Existence of the a1–3 and a1–6 difucosylated innermost GlcNAc residue in a molluscan glycoprotein pot

... reducing end GlcNAc When subjected to linkage analysis, glycan B1 gave terminal Fuc, terminal Man, terminal Gal, 3,6-linked Man, 4-linked GlcNAc and, importantly, a peak that can be assigned as ... Kumamoto, Japan) and purified using DEAE-cellulose (Whatman, Maidstone, Kent, UK) and concanavalin A Sepharose 4B (Amersham Biosciences, Piscataway, NJ, USA) column chromatography a- Methyl mannoside in ... Wada, Y., Awaya, J., Kurono, M & Takahashi, N (1991) Calculated two-dimensional sugar map of pyridylaminated oligosaccharides: elucidation of the jack bean a- mannosidase digestion pathway of Man9GlcNAc2...

Ngày tải lên: 23/03/2014, 17:22

6 430 0
Báo cáo khoa học: "HOW TO DETECT GRAMMATICAL ERRORS IN A TEXT WITHOUT PARSING IT" doc

Báo cáo khoa học: "HOW TO DETECT GRAMMATICAL ERRORS IN A TEXT WITHOUT PARSING IT" doc

... see [Atweli 8 6a, 86b, forthcoming c], [Atwell and Drakos 87] The general Constituent Likelihood approach to grammatical analysis, and CLAWS in particular, can be used to analyse text including ... for each word, as before, and then measuring ABSOLUTE LIKELIHOODS of tagpairs Instead of a separate tag-pair error likelihood table to assess the grammaticality, the same tag-pair frequency table ... chosen grammatical tag; this likelihood is normalised relative to a threshold, so that values greater than one constitute "acceptable" grammatical analyses, whereas values less than one am indicative...

Ngày tải lên: 24/03/2014, 05:21

8 471 0
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

... (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by RT-PCR was performed using the forward primer radiolabeled with [c-32P]ATP (Furui, Beijing, China) ... proteins, a family of proteins containing one or two RNA-binding domains and a signature RS domain rich in Arg ⁄ Ser dipeptides, and splicing silencers usually recruit heterogeneous nuclear RNPs, a set ... conservation in 52 HBV genomes was calculated and the graphic representation was created by WebLogo [47] The HP1 and HP2 regions are indicated, with stems being marked by cyan bars and the RNase-accessible...

Ngày tải lên: 28/03/2014, 23:20

14 379 0
Báo cáo khoa học: Tumor suppressor p16INK4a: Downregulation of galectin-3, an endogenous competitor of the pro-anoikis effector galectin-1, in a pancreatic carcinoma model pptx

Báo cáo khoa học: Tumor suppressor p16INK4a: Downregulation of galectin-3, an endogenous competitor of the pro-anoikis effector galectin-1, in a pancreatic carcinoma model pptx

... well as a signal attenuating extracellular signal-regulated kinase [23] This is in accordance with the lack of aberrantly enhanced extracellular signal-regulated kinase signaling in pancreatic tumors ... Biochemical characterization of endogenous carbohydrate-binding proteins from spontaneous murine rhabdomyosarcoma, mammary adenocarcinoma, and ovarian teratoma J Natl Cancer Inst 73, 1349–1357 ´ Andre ... p16INK 4a protein had an effect A clear decrease in the intensity of signals for Gal-3 was invariably observed, although proliferating cell nuclear antigen (PCNA) staining as a control for loading...

Ngày tải lên: 29/03/2014, 21:20

12 373 0
Báo cáo khoa học: "FOCUS AND ACCENT IN A DUTCH TEXT TO-SPEECH SYSTEM" potx

Báo cáo khoa học: "FOCUS AND ACCENT IN A DUTCH TEXT TO-SPEECH SYSTEM" potx

... dominating unfocussed material are [-focus] In order to arrive at an accentuation pattern, three rules and a well-formedness condition are to be applied to this input A first rule (see (2)) applies ... arguments are normally labelled s and therefore likely to receive accent, there are some cases where we not want an argument to be accented A case in point are [-focus] pronouns In (Ta) we have ... may not be Assigning focus A s s n r n l n ~ that a programme for semantic interpretation of unrestricted Dutch text will not be available within the near future, the following practical strategy...

Ngày tải lên: 01/04/2014, 00:20

5 301 0
a first course in the finite element method

a first course in the finite element method

... (2) beam bending, leading to plane frame and grid analysis and space frame analysis; (3) elementary plane stress/strain elements, leading to more advanced plane stress/strain elements; (4) axisymmetric ... used in this text A matrix is a rectangular array of quantities arranged in rows and columns that is often used as an aid in expressing and solving a system of algebraic equations As examples ... this text I am especially grateful to Ron Cenfetelli, Barry Davignon, Konstantinos Kariotis, Koward Koswara, Hidajat Harintho, Hari Salemganesan, Joe Keswari, Yanping Lu, and Khailan Zhang for...

Ngày tải lên: 08/04/2014, 10:35

836 4,3K 0
learn  windows  powershell  3  in  a  month  of  lunches  2nd  edition

learn windows powershell 3 in a month of lunches 2nd edition

... the hard work 270 Making parameters mandatory 271 Adding parameter aliases 273 Validating parameter input 274 Adding the warm and fuzzies with verbose output Lab 277 Advanced remoting configuration ... optional—both it and its value are enclosed in square brackets Within those, -InstanceId itself is also contained in square brackets, indicating that this is also a positional parameter It appears ... press Tab to start cycling through matching parameters Hit Escape to clear the command line  Type Set-Execu again, and press Tab Type a space, then -E, and hit Tab again Type another space, and...

Ngày tải lên: 05/05/2014, 14:44

367 1,3K 0
w