3 setting the data protection mode of a data guard configuration

Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

... pathway for hyperosmolarity adaptation in budding yeast (Saccharomyces cerevisiae) and based on the related mRNA expression time-series data from Stanford Microarray Databases Results Inferring the ... kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic cells [20,21] The budding yeast (S cerevisiae) has several MAPK cascades ... intervention of other nodes or parameters Sontag et al [15] have proposed another complementary method based on time-series measurements, which can be useful when stationary data are not available and the...

Ngày tải lên: 07/03/2014, 21:20

10 375 0
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

... between Arg56 and the O2 of the nucleobase However, after evaluating both crystal structures we conclude that the alternative orientation of the base and sugar–phosphate backbone of the nucleotide ... that the first three b strands may form association interfaces that promote aggregate growth In the late stage of amyloid formation, signals from the N-terminal half of the molecules (equivalent ... from a different chain and vice versa The swapped chains can be interrelated by a noncrystallographic twofold rotation axis The functional units align well with the structures of the two models of...

Ngày tải lên: 23/03/2014, 09:21

15 333 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... modeled The simulator runs until all clean segments are exhausted, then simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

... 5.1 Variation of global solar radiation and ambient temperature The year round global solar radiation and ambient temperature data for Chennai is taken from [34] Figure shows the variation of global ... Al-Abbasi M .A. , Al-Karaghouli A. A., Minasian A. N Photochemically assisted solar desalination of saline water Desalination 1992, 86(3), 317–324 [4] Mowla D, Karimi G Mathematical modeling of solar still ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged...

Ngày tải lên: 05/09/2013, 16:11

26 568 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language ... writer playing the role as recounter - Kumiko Tsuchida, the railway guard, the police, and the Japanese embassy Mode: Mood: declarative Modality: ability of the main character on the past - Medium...

Ngày tải lên: 07/09/2013, 13:48

39 827 2
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... Subject The spaceship The planet They There The spaceship The two astronauts The woman It She We It Both of them They All plants and Animals They They Everything The man Nothing Something He I The...

Ngày tải lên: 12/02/2014, 20:20

18 714 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... another single-domain phytase may improve the catalytic efficiency of the latter Materials and methods Strains, plasmids and chemicals E coli Trans1-T1 (TransGen, Beijing, China) and pGEM-T Easy ... sum of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

... the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation ... 1948, Dhaka and Urdu were declared West Bank might claim that the Bangladesh Liberation the of cial languages of all of Pakistan This proved War and the secession of East Pakistan was the result ... down the of ces of the pan-Arab Al have by facilitating the spread of Gaza’s lawlessness into the West Bank and ultimately to Israel Masked Fatah gunmen have occupied various PA fence, since large...

Ngày tải lên: 16/02/2014, 11:20

64 307 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... because these are the most distant pair of haems in the structure and are therefore expected to have the weakest interaction [33] The pH dependence of the chemical shifts of the NMR signals of the ... thermodynamic model to the NMR data (for the case of DvHc3:ZnRb), or to the NMR and UV-visible data sets simultaneously (for the case of DvHc3:Pi) using the Marquardt method for parameter optimization...

Ngày tải lên: 19/02/2014, 17:20

10 640 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

... Proxies If data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade to ... pull, the system must allocate additional threads to allow the application to make progress while the I/O Facade task is blocked However, 2: Demarshaled data adding threads to the system has many ... data from a sensor is given to an appropriate Sensor Proxy Each Sensor Proxy object demarshals the incoming data and notifies I/O Facade objects that depend on the sensor’s data Since modern aircraft...

Ngày tải lên: 19/02/2014, 18:20

20 738 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful ... aspartate in the catalytic triad is not fully understood because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases,...

Ngày tải lên: 21/02/2014, 03:20

7 603 0
Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

... Annals of Mathematics, 159 (2004), 1247–1274 Numerical characterization of the K¨hler cone of a compact K¨hler manifold a a By Jean-Pierre Demailly and Mihai Paun Abstract The goal of this ... there exists a very neat characterization of nef classes on arbitrary surfaces, K¨hler or not a The Main Theorem has an important application to the deformation theory of compact K¨hler manifolds, ... can also view this fact as a characterization of the dual cone of the nef cone, in the space of real cohomology classes of type (n − 1, n − 1) This leads immediately to Corollary 0.4 In the case...

Ngày tải lên: 05/03/2014, 23:20

29 468 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... that factor Xa cleaved and activated proHP8Xa When activated HP8Xa was mixed with proSpatzle¨ 1A, the 38 kDa pro-Spatzle band disappeared, and a ¨ 12 kDa product was produced (Fig 7A) N-terminal ... analysis using antiserum against M sexta HP8 Bands representing the proHP8Xa zymogen, a truncated form of proHP8Xa and the catalytic domain of active HP8 are marked with arrowheads The size and ... exchange chromatography SDS ⁄ PAGE analysis in the presence of b-mercaptoethanol indicated that the purified Spatzle had an ¨ apparent molecular mass of 38 kDa, which is slightly larger than that...

Ngày tải lên: 06/03/2014, 09:22

15 541 0
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf

Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf

... et al Crystal structure of salt-tolerant glutaminase A B Fig L-Glutamate in complex with Mglu and asparaginase of Erwinia carotovora LGlutamate (cylinder) on the surfaces of the structures of ... significant conformational change upon the binding of ligand [31] The smaller size of l-glutamine than the substrates for b-lactamase could be one of the reasons for the conformational changes of the ... a Backbone atoms of the N-terminal domains (1-305 aa) in the T and TG structures are aligned b Backbone atoms of Bacillus glutaminase are superimposed on those of the liganded enzyme c The value...

Ngày tải lên: 06/03/2014, 09:22

11 522 0
Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

... Another insider installs a keystroke logger to get a few passwords to another computer in the same office • A database administrator makes an extra copy of the database files, but says the tapes ... for the development of such datasets include a MITRE dataset of normal, and “insider threat” network activities; data from the ARDA NIMD4 study; data obtained from use of the Glass Box5 software; ... Breakout sessions considered what databases would aid in this research if they were available Researchers need databases containing examples of specific attacks, the characterization of normal...

Ngày tải lên: 06/03/2014, 16:20

137 344 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

... YGR287c The sequence data for isomaltase is available from the DNA Data Bank of Japan with accession number AB109221 The entire coding region of the insert was amplified by PCR and subcloned into the ... II of maltase is the catalytic nucleophile Because the Asp214 of maltase is equivalent to the Asp215 of isomaltase, a mutant with the residue altered to Ala was tested for its activity on a- pNPG ... recombinant enzymes reacted with antisera against native maltase and isomaltase, the recombinant enzymes showed the same dose–response as the native enzymes by antiserum neutralization (data not...

Ngày tải lên: 07/03/2014, 16:20

7 452 0
The Project Gutenberg EBook of A First Book in Algebra, pot

The Project Gutenberg EBook of A First Book in Algebra, pot

... − 7a − 3a From take 2a 5a − 3a To add 2a − 5a − 3a From take − 4a To − 4a − 3a add 3a a a The principle is clear; namely, The subtraction of any number gives the same result as the addition of that number ... remain in the tank at the end of five days? 18 Two men are 150 miles apart, and approach each other, one at the rate of x miles an hour, the other at the rate of y miles an hour How far apart ... number of apple trees How many are there of each kind? John and Mary gathered 23 quarts of nuts John gathered quarts more than twice as many as Mary How many quarts did each gather? To the double of...

Ngày tải lên: 15/03/2014, 00:20

189 432 0
The Design and Implementation of a Sequence Database System * docx

The Design and Implementation of a Sequence Database System * docx

... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference ... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... array and list constructs that allow collections of data to be ordered The object-relational database systemIllustra [I11941 provides database support for time-seriesdata along with relational...

Ngày tải lên: 16/03/2014, 16:20

12 569 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

... sequence was 5¢-GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3¢, with GAC, CAA and TCA as mutated codons for E451D, E451Q and E451S, respectively DNA sequencing was used to confirm the incorporation ... affected by the exchange of a charged participant (carboxyl group of the E side-chain) for an uncharged participant (amide group of the Q side-chain) Otherwise, the replacement of E451 with D and S ... ÔeÕ stands for an equatorial hydroxyl and a for an axial one Therefore, the interaction between any residue at position 39 and an equatorial 4-OH was called /4e, and between any residue at position...

Ngày tải lên: 16/03/2014, 18:20

9 371 0
w