2thermal phenomena in porous multi component ceramic materials at high temperatures
A study of moisture diffusion in polymeric packaging materials especially at high temperatures
Ngày tải lên :
26/09/2015, 10:05
... Titration was explained as the outgassing at high temperatures by investigating the nature of polymeric materials Results from Gas Chromatography/Mass Spectrometry (GC/MS) also showed that outgassing ... They indicate that water molecularly disperse in the epoxy rather than aggregate in a water-like state within voids There is no evidence for multiple sites for water It has been speculated that ... reason for this uncertainty is that at high temperatures, volatiles in the polymeric packaging materials may be given off in addition to moisture Chapter Introduction The main purpose of this research...
- 143
- 431
- 0
The interference of mother tongue as vietnames in learning english souds and stress at high school = ảnh hưởng của tiếng mẹ đẻ đối với việc học âm và trọng âm tiếng anh ở trường phổ thông
Ngày tải lên :
18/12/2013, 21:45
... English in forming grammatical endings, and in pronouncing of grammatical endings Vietnamese learners have difficulties in pronouncing suffixes showing grammatical meanings that are not 33 present in ... words Pronunciation of Grammatical Endings 5.1 Pronunciation of Grammatical Endings in English 2.5.1.1 The Importance of Pronunciation of Grammatical Endings We know that English is an inflected ... Clusters in Vietnamese 26 2.3 Sound Linking .26 2.3.1 Sound Linking in English .26 2.3.2 Sound Linking in Vietnamese 27 Sound- Spelling Correspondence .28 4.1 Principles...
- 50
- 3.1K
- 9
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
Ngày tải lên :
16/02/2014, 09:20
... CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT ... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... Schleuning WD (1987) Phorbol ester induces the biosynthesis of glycosylated and nonglycosylated plasminogen activator inhibitor in high excess over urokinase-type plasminogen activator in human...
- 14
- 635
- 0
Computational Modelling of Multi-Scale Non-Fickian Dispersion in Porous Media - An Approach Based on Stochastic Calculus docx
Ngày tải lên :
28/06/2014, 08:20
... pumping patterns to determine matching patterns Rogers et al (1995) took another step forward to simulate the regulatory index, remedial index and cost index by using ANN for groundwater remediation ... advection-dispersion in porous media found in practical situations, especially involving natural porous formations By using stochastic partial differential equations, for example, we could incorporate the ... discontinuities at finitely many points and we integrate them using the definition of Riemann integral of a function f (t) over the interval [a,b]: b a n f (t ) dt lim f ( in ) ( tin tin...
- 242
- 308
- 0
CERAMIC MATERIALS – PROGRESS IN MODERN CERAMICS pptx
Ngày tải lên :
28/06/2014, 10:20
... sharp increase in the dielectric permittivity with increasing dc bias fields at temperatures close to the ferroelectric-relaxor phase transition, indicating that the dc bias is inducing the creation ... of the sintered ceramics body 32 Ceramic Materials – Progress in Modern Ceramics Fig The XRD pattern of the sintered ceramics body In large (diameter/thickness) ratio piezoelectric ceramic disk, ... and inert materials Things are made from them by the action of heat and subsequent cooling, which may be crystalline or partly crystalline The definition of ceramic is often restricted to inorganic...
- 240
- 325
- 2
Computational modelling of multi-SCale non-fiCkian diSperSion in porouS media - an approaCh BaSed on StoChaStiC CalCuluS ppt
Ngày tải lên :
29/06/2014, 09:20
... pumping patterns to determine matching patterns Rogers et al (1995) took another step forward to simulate the regulatory index, remedial index and cost index by using ANN for groundwater remediation ... advection-dispersion in porous media found in practical situations, especially involving natural porous formations By using stochastic partial differential equations, for example, we could incorporate the ... discontinuities at finitely many points and we integrate them using the definition of Riemann integral of a function f (t) over the interval [a,b]: b a n f (t ) dt lim f ( in ) ( tin tin...
- 242
- 201
- 0
research on fabrication and the physical properties of the multi-component ceramics based on pzt and the relaxor ferroelectric materials
Ngày tải lên :
04/12/2014, 02:54
... lowering sintering temperature of PZT based ceramics is very necessary In order to reduce the sintering temperature at which satisfactory densification could be obtained, various material processing ... peaks at 44.5o (insert picture in Figure 2.10) The c/a ratio decreases with increasing Zr/Ti ratio, indicating that the tetragonality of PZT-PZN-PMnN ceramics decreased when Zr increased With increasing ... materials scientists have been intensively investigating the application of multi- component ceramic systems combining the normal ferroelectric PZT and relaxor ferroelectric materials such as: Pb(Zr,Ti)O3...
- 52
- 341
- 0
Assessment of the Use of Hand Warmer for Nitrate Retardation in Porous Media
Ngày tải lên :
05/09/2013, 10:15
... (Saturated) (Unsaturated) Andisol (Saturated) (Unsaturated) 0.5 0 10 12 14 16 Mixture ratio of hand warmer contents (%) 10 Silica sand (Saturated) (Unsaturated) Andisol (Saturated) (Unsaturated) ... transport using temporal moment approaches, which are stated in the following subsection Pore water samples at the end of the column were taken at specific intervals Nitrate ion in the pore water samples ... solute concentration In a practical situation, natural degradation of nitrate concentration and the subsequent reduction of nitrate loading to groundwater are expected due to denitrification by microorganisms...
- 8
- 523
- 0
A study on second year student's difficulties in reading esp materials at automobile technology departement in vietnam korea technical college
Ngày tải lên :
18/12/2013, 10:03
... ideas, supporting ideas and examples - processing and evaluating the information during reading - transferring or using the information while or after reading 2.4.4 ESP reading materials Materials ... - Overcoming limitations in speaking and writing Indirect strategies Metacognitive strategies: - Centering your learning - Arranging and planning your learning - Evaluating your learning Affective ... PEDAGOGICAL IMPLICATIONS 4.1 Increasing students’ reading interest and motivation 4.1.1 Making ESP interesting 64 64 64 4.1.1.1.Using visual aids in teaching reading 65 4.1.1.2 Diverstifying reading activities...
- 101
- 636
- 0
Tài liệu Mental Health in a Multi-ethnic Society A Multi-disciplinary Handbook docx
Ngày tải lên :
15/02/2014, 02:20
... practitioners working in the mental health field, it is also suitable for multi- disciplinary trainings, basic trainings and in- service postgraduate trainings in a variety of professions including social ... ‘illness’ is something that can be clearly defined A recent example is that of the tragedy involving Christopher Clunis, resulting in recommendations that concentrate on ways of ‘treating’ the ‘illness’ ... in writing from the publishers British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloging in Publication...
- 250
- 457
- 0
Tài liệu Báo cáo khoa học: "Multi-Component TAG and Notions of Formal Power" docx
Ngày tải lên :
20/02/2014, 18:20
... is well-known that allowing both types of adjunction creates derivational ambiguity Vijay-Shanker, 1987 : adjoining at the foot of produces the same derived tree that adjoining at the root of ... demonstrating that natural language is not context-free Shieber, 1985 RMCTAG is thus a more constrained relaxation of the notion of immediate dominance in favor of non-immediate dominance than ... grammars In Proceedings of the 33rd Annual Meeting of the Association for Computational Linguistics ACL '95 James Rogers 1994 Capturing CFLs with tree adjoining grammars In Proceedings of the...
- 8
- 374
- 0
Tài liệu Báo cáo khoa học: "Automatic Detection of Nonreferential It in Spoken Multi-Party Dialog" doc
Ngày tải lên :
22/02/2014, 02:20
... Identifying non-referential it: a machine learning approach incorporating linguistically motivated patterns In Proceedings of the ACL Workshop on Feature Selection for Machine Learning in NLP, ... boundary information All of the features described in the following were obtained fully automatically That means that errors in the shallow feature generation methods could propagate into the ... & K Satou (2004) Improving the identification of non-anaphoric it using Support Vector Machines In International Joint Workshop on Natural Language Processing in Biomedicine and its Applications,...
- 8
- 436
- 0
Báo cáo khoa học: "Resolving It, This, and That in Unrestricted Multi-Party Dialog" potx
Ngày tải lên :
08/03/2014, 02:21
... weekly meetings of a quite informal conversational style, containing many interrupts, asides, and jokes (Janin, 2002) The corpus features a semi-automatically generated segmentation in which each ... Table 2: Anaphoric chains in core data set Automatic Preprocessing Data preprocessing was done fully automatically, using only information from the manual transcription Punctuation signs and some ... + INFINITIVE were modelled by creating markables for the individual expressions, and attaching them to each other with labelled relations like INFINITIVE COMP NP chunks were also attached, using...
- 8
- 378
- 0
Scott meyers effective c++ in an embedded environment presentation materials
Ngày tải lên :
19/03/2014, 14:13
... C++ in an Embedded Environment The Pros and Cons of Inlining inline is only a request — compilers are free to ignore it: Compilers rarely inline virtual function calls: Inlining occurs at ... C++ in an Embedded Environment Overview Day (Approximate): “C++” and “Embedded Systems” A Deeper Look at C++ Implementing language features Understanding inlining Avoiding code bloat ... C++ in an Embedded Environment Overview Day (Approximate): “C++” and “Embedded Systems” A Deeper Look at C++ Implementing language features Understanding inlining Avoiding code bloat...
- 320
- 547
- 1
STOCHASTIC DYNAMICS Modeling Solute Transport in Porous Media pptx
Ngày tải lên :
22/03/2014, 15:20
... pertaining to a single problem: stochastic flow of contaminant transport in the saturated porous media such as that we find in underground aquifers In attempting to solve this problem using stochastic ... finite positive quadratic variation within an interval, then its variation is infinite It also means that such functions are continuous but not differentiable We not use quadratic variation in ... developments in mathematics We have attempted to explain the ideas in an intuitive manner wherever possible without compromising rigor We have used the solute transport problem in porous media saturated...
- 253
- 230
- 0
Báo cáo khoa học: A pH-dependent conformational change in EspA, a component of the Escherichia coli O157:H7 type III secretion system potx
Ngày tải lên :
30/03/2014, 16:20
... urea-induced denaturation data indicated a decreased stability and cooperativity against urea-induced unfolding for EspA at pH 2.0 compared with that at pH 7.0 This suggests that some conformational ... concentration of EspA indicate that the oligomeric EspA at pH 7.0 can tend to dissociate into monomers at pH 2.0 since the oligomerization into native structure should prevent the formation of ... unfolding curves shown in Figs and U, Unfolded state; IA, acid-induced intermediate state; NI, native state at neutral pH; NII, native state at acidic pH The transition midpoints for NI (or NII)...
- 11
- 475
- 0
NONLINEAR PHENOMENA IN HYDRAULIC SYSTEMS
Ngày tải lên :
30/03/2014, 20:21
... pneumatic drives with very high rigidity that are suitable for use in the handling and assembling industry Fig 16 shows some miniature precisely guided pneumatic actuators that suit the applications ... Vorhub des Zylinderkolbens cylinder pin mounting fixation par axe dun vộrin See cylinder eye mounting Voir fixation par oreilles dun vộrin cylinder piston piston (m) de vộrin Zylinderkolben (m) ... solution that suits their application Fig A swivelling/linear unit Fig shows pneumatic units used in an assembling system This includes a linear and rotary cylinder combined with a high precision...
- 118
- 671
- 0
Heat and Mass Transfer in Porous Media pdf
Ngày tải lên :
31/03/2014, 16:20
... degradation in wall renderings These include: surface alterations (fluorescences or damp patches); cracking; the formation of crusts; the separation of building materials into layers (delamination, ... existing in the building materials, threatening its durability For this reason, the relative humidity value at the entrance had to be limited Treatment of Rising Damp in Historical Buildings ... Properties of Multi- Component Porous Ceramic Materials Used in High- Temperature Processes in the Foundry Industry Z Ignaszak and P Popielarski Metal Foams Design for Heat Exchangers:...
- 270
- 1.9K
- 3
Báo cáo khoa học: "THE LEXICAL EXPRESSIONS SEMANTICS OF COMPARATIVE IN A MULTI-LEVEL SEMANTIC PROCESSOR" ppt
Ngày tải lên :
31/03/2014, 18:20
... new instance of that class resulting from the combination of zero or more old instances For example, if John combines the oil from three cans into a large vat, the oil in that vat is an aggregation ... extra components that indicate the base order and the mapping to he used in DML This additional information is used to enforce the Codomain Agreement Principle and to help in the user interaction ... 159-219 Bates, Madeleine and Bobrow, Robert J 1983 Information Retrieval Using s Transportable Natural Language Interfxce In: Research and Development in Information Retrieval: Proceedings of...
- 8
- 402
- 0