26 splitting up a purchase line for inclusion in multiple forecasts

Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc

Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc

... entry for -lH Jack Hoeksema and Richard D Janda 1988 Implications of process-morphology for categorial grammar In R T Oehrle, E Bach, and D Wheeler, editors, Categorial Grammars and Natural Language ... functions as a basis for grammatical analysis In R T Oehrle, E Bach, and D Wheeler, editors, Categorial Grammars and Natural Language Structures, D Reidel, Dordrecht, 1988 C Pollard and I A Sag 1994 ... m a t i o n S t r u c t u r e and Tactical Constraints Entries in the eategorial lexicon have tactical constraints, grammatical and semantic features, and phonological representation Similar...

Ngày tải lên: 08/03/2014, 07:20

3 339 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid Hypoxanthine and guanine may enter in a salvage pathway, using hypoxanthine-guanine ... chemotherapy and renal impairment Standard measures to prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features ... of activity Int J Med Sci 2007, 4 Rasburicase pharmacokynetics Information about pharmacokinetics derives by the use of rasburicase in children and young adults Few data are available in adults...

Ngày tải lên: 31/10/2012, 14:59

11 716 0
Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx

Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx

... clinical and non-clinical populations with psychological complaints and has been validated in primary health care [31,32] and in occupational health care [7,29] The four scales of the DSQ are internally ... to as a stress management training [35,36] And although the term stress management training may suggest a rather uniform set of intervention strategies, it usually refers to a mixture of treatment ... important cause may be the lack of a cutoff point in most studies for selecting participants [34] It is a lamentable omission for current stress management programs and guidelines that we miss clear...

Ngày tải lên: 20/06/2014, 00:20

8 396 0
Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps

Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps

... Tsuchiya KJ, Takagai S, Kawai M, Matsumoto H, Nakamura K, Minabe Y, Mori N, Takei N: Advanced paternal age associated with an elevated risk for schizophrenia in offspring in a Japanese population ... TF, Saha S, Welham J, O’Callaghan E, Cantor-Graae E, Chant D, Mortensen PB, McGrath J: Paternal and maternal age as risk factors for psychosis: findings from Denmark, Sweden and Australia Schizophr ... Johanson E: A study of schizophrenia in the male Acta Psychiatrica Neurological Scandinavica 1958, 33(Suppl 125):7-107 Hare EH, Moran PA: Raised parental age in psychiatric patients: evidence for...

Ngày tải lên: 09/08/2014, 01:21

6 406 0
Báo cáo y học: "A proinflammatory role for Fas in joints of mice with collagen-induced arthritis" docx

Báo cáo y học: "A proinflammatory role for Fas in joints of mice with collagen-induced arthritis" docx

... 99:245-250 Sakata K, Sakata A, Vela-Roch N, Espinosa R, Escalante A, Kong L, Nakabayashi T, Cheng J, Talal N, Dang H: Fas (CD95)-transduced signal preferentially stimulates lupus peripheral T lymphocytes ... The measurements were made in triplicate Histopathological analysis of joints Histopathological features of peripheral joints were assessed in hematoxylin-stained formalin-fixed paraffinembedded ... an allelic combination derived from the original inbred strains Arthritis Rheum 2002, 46:1067-1074 Sugiyama M, Tsukazaki T, Yonekura A, Matsuzaki S, Yamashita S, Iwasaki K: Localization of apoptosis...

Ngày tải lên: 09/08/2014, 01:23

11 469 0
Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx

Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx

... recombinant founder pair was identified, the RI line was maintained via a single line of descent All RI lines were bred and maintained under specific pathogenfree conditions in the animal facility ... Kit (Qiagen Inc., Valencia, CA, USA) from a small tail snip taken between and weeks of age just prior to weaning Each DNA sample was used as a template in polymerase chain reaction amplification ... representative data showing differences in salivary flow rates among the Aec2 RI lines are shown in Figure For example, both male and female mice of RI lines RI09, RI33, and RI12, all of which retained...

Ngày tải lên: 09/08/2014, 13:22

12 399 0
báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx

báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx

... that the sub-dimensions were part of a single, supraordinate theme of ‘neurological fatigue’ Fit of scale data to the Rasch model also allows for a transformation of the ordinal raw score to an ... and breaches of local dependency, including multi-dimensionality The summary findings related to the analysis of each domain are given in Table Physical scale Rasch analysis of the 16 Physical ... generated data set of the same size Only factors with eigenvalues exceeding the values obtained from the corresponding random data set are retained for further investigation Parallel analysis was conducted...

Ngày tải lên: 12/08/2014, 01:21

10 356 0
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... AGGCAGTCCGTAACATCCAC, Reverse; CTTCAGTCCGTAACATCCAC) and STIM2 (Forward; TCCCTGCATGTCACTGAGTC, Reverse; GGGAAGTGTCGTTCCTTTGA) Cycling was performed 35 times; 94°C, followed by 55°C (annealing temperature),...

Ngày tải lên: 12/08/2014, 16:20

8 341 0
Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx

Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx

... for human bactin, 5’-TGGCACCCAGCACAATGAA-3’; and reverse primer for human b-actin, 5’-CTAAGTCATAGTCCGCCTAGAAGCA-3’ Primer efficiency was determined by serially diluting a standard RT reaction product ... http://arthritis-research.com/content/13/4/R124 washing step, a 15,000-fold dilution of anti goat IgG alkaline phosphatase-conjugated antibody (Sigma) was added, and plates were incubated for 30 minutes at room temperature Following another ... USA) We repeated the ELISA three times and obtained the similar results Sandwich ELISA has low inter-assay and intra-assay variability and provides more accurate results than direct ELISA in...

Ngày tải lên: 12/08/2014, 17:22

16 321 0
Báo cáo y học: "A Functional Role for ADAM10 in Human Immunodeficiency Virus Type-1 Replication" pptx

Báo cáo y học: "A Functional Role for ADAM10 in Human Immunodeficiency Virus Type-1 Replication" pptx

... were against positions 1119-1138 (5’ CCCAAAGTCTCT CACATTA-3’), 1272-1280 (5’-GGACAAACTTAAC AACAAT-3’), 1591-1609 (GCAAGGGAAGGAATATGTA-3’), and 2070-2088 (5’-GCTAATGGCTGG ATTTATT-3’) TZM-bl and ... domain potentially responsible for this increase was further investigated ADAM10 E38 4A plasmid contains a single inactivating point mutation in the metalloprotease domain rendering the metalloprotease ... domain, it also contains a disintegrin domain, an EGFlike domain, a cysteine-rich domain, a transmembrane domain, and a cytoplasmic domain [13] ADAM10 is required in NOTCH signaling during embryogenesis...

Ngày tải lên: 13/08/2014, 01:20

14 308 0
Báo cáo y học: " A retrospective cohort pilot study to evaluate a triage tool for use in a pandemic" pps

Báo cáo y học: " A retrospective cohort pilot study to evaluate a triage tool for use in a pandemic" pps

... care (%) 1 Awaiting cc/rehab Discharged N (%) N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A (3.3) N /A N /A (5.9) 63 N /A N /A 20 N /A N /A N (%) Life support (%) 43 N /A 90-day status* N /A N /A Home (46.1) ... criteria Severe trauma N /A N /A Severe burn N /A N /A Cardiac arrest N /A 12 N /A Severe cognitive impairment N /A N /A Advanced neuromuscular disease N /A N /A Metastatic malignancy N /A N /A Advanced & ... 'transfer to another acute care facility' Statistical analysis We present descriptive data using mean and standard deviation for continuous variables, or median and interquartile ranges if data...

Ngày tải lên: 13/08/2014, 19:20

9 271 0
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery

Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery

... AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 Immunocytochemical staining for pluripotent markers: ... schizophrenia, Alzheimer‘s disease, Cancer, spinal cord injuries, diabetes and many more, stem cells may also materialized the hope of growing limbs and organs in laboratory for transplantation in future ... (Bio-Rad,Hercules, CA,USA) Primers used for PCR cycles are listed below in the following page with β-actin as control 20 Annealing Gene Primer sequence Temp OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC...

Ngày tải lên: 16/10/2015, 15:38

117 385 0
Laying the foundations a new era for rd in the middle east

Laying the foundations a new era for rd in the middle east

... contains branches from six major US universities, including Texas A& M and Carnegie Mellon “I think Qatar is doing a fantastic job of attracting top universities and building an educational infrastructure ... years ago.” Better co-ordination between regulators that review marketing authorisation and those that regulate clinical trials should lead to an increasing volume of late-stage R&D taking place ... Arab Emirates in 44th position But over the past few years, investment in the infrastructure and institutions for R&D has accelerated dramatically in some countries Qatar, the UAE and Saudi Arabia,...

Ngày tải lên: 06/12/2015, 23:04

42 221 0
 Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying the ... testing for additional tachycardias, which could potentially have been masked by the now ablated primary tachycardia, was performed The aforementioned endpoints were re-evaluated after a waiting ... (5) and insufficient (6)) Patients with AVNRT, AVRT and EAT rated their state of health before and after ablation The changes within the ranking scale before and after ablation is demonstrated in...

Ngày tải lên: 03/11/2012, 11:44

9 679 0
UP AND AWAY: A resource book for English language support in primary schools pptx

UP AND AWAY: A resource book for English language support in primary schools pptx

... concepts and vocabulary have been studied in advance and there is appropriate visual support • Can understand the main points of stories that are read aloud in the mainstream classroom • Can understand ... effective in many schools In some schools the language support teacher has a regular timetable for attending mainstream classes to carry out intercultural learning activities, in particular under ... is maintained for each pupil from the day of arrival which focuses on: Psychosocial adjustment Language learning Continuity of academic learning Checklist 4: Inclusivity in the mainstream classroom...

Ngày tải lên: 19/03/2014, 08:20

248 776 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

... S4) Increasing rates of GSH consumption are paralleled by increasing rates of NADPH consumption A decrease in the NADPH NADP ratio activates G6PD and results in a monotone, quasilinear increase ... concentration, and lactate concentration, within the following physiologically feasible ranges: k kATPase k0 ATPase ATPase (small variation of the energetic load) k kATPase k0 ATPase ATPase (large variation ... effectors, all cellular kinases and phosphatases as potential chemical modiers, and all cellular membranes as potential activating or inactivating scaffolds However, the experimental effort actually...

Ngày tải lên: 23/03/2014, 06:20

15 456 0
Báo cáo khoa học: "A Seed-driven Bottom-up Machine Learning Framework for Extracting Relations of Various Complexity" pdf

Báo cáo khoa học: "A Seed-driven Bottom-up Machine Learning Framework for Extracting Relations of Various Complexity" pdf

... domain One of the target relations in the domain is about a person who obtains a special prize in a certain area in a certain year, namely, a quaternary tuple, see (3) (4) is a domain relevant ... effective in learning patterns for some general binary relations such as booktitle-author and company-headquarter relations In Xu et al (2006), the authors show that at least for the investigated task ... the argument role combination information and the unique id With this approach, we can learn rules like (6) in a straightforward way 4.2 Rule Validation: Ranking and Filtering Our ranking strategy...

Ngày tải lên: 23/03/2014, 18:20

8 335 0
The financial reporting framework may not provide specific guidance for inclusion or exclusion of a docx

The financial reporting framework may not provide specific guidance for inclusion or exclusion of a docx

... 13 International Auditing and Assurance Standards Board ISA 600 (Revised and Redrafted) October 2007 Revised and Redrafted International Standard on Auditing ISA 600, Special Considerations― Audits ... Statements (Including the Work of Component Auditors‖ was prepared by the International Auditing and Assurance Standards Board (IAASB), an independent standard-setting body within the International Federation ... Group Financial Statements (Including the Work of Component Auditors) This is trial version www.adultpdf.com International Auditing and Assurance Standards Board International Federation of Accountants...

Ngày tải lên: 19/06/2014, 21:20

10 176 0
w