22 g l reactions on solid catalyst trickle beds slurry reactors three phase fluidized beds
Tài liệu Lab 6.2.8 Password Recovery Procedure on a Catalyst 2900 Series Switches ppt
Ngày tải lên :
24/01/2014, 19:20
... ALSwitch(config)#enable password Cisco ALSwitch(config)#line console ALSwitch(config-line)#password cisco ALSwitch(config-line)#exit ALSwitch(config)#line vty 15 ALSwitch(config-line)#password cisco ALSwitch(config-line)#exit ... Destination filename [running-config][enter] e The configuration file is now reloaded Change the old unknown passwords as follows: ALSwitch#configure terminal ALSwitch(config)#no enable secret ALSwitch(config)#enable ... ALSwitch(config-line)#exit ALSwitch(config)#exit ALSwitch#copy running-config startup-config Destination filename [startup-config]?[enter] Building configuration [OK] ALSwitch# f Power cycle the...
- 7
- 327
- 0
Tài liệu Lab 6.2.8 Password Recovery Procedure on a Catalyst 2900 Series Switches docx
Ngày tải lên :
24/01/2014, 19:20
... ALSwitch(config)#enable password Cisco ALSwitch(config)#line console ALSwitch(config-line)#password cisco ALSwitch(config-line)#exit ALSwitch(config)#line vty 15 ALSwitch(config-line)#password cisco ALSwitch(config-line)#exit ... Destination filename [running-config][enter] e The configuration file is now reloaded Change the old unknown passwords as follows: ALSwitch#configure terminal ALSwitch(config)#no enable secret ALSwitch(config)#enable ... ALSwitch(config-line)#exit ALSwitch(config)#exit ALSwitch#copy running-config startup-config Destination filename [startup-config]?[enter] Building configuration [OK] ALSwitch# f Power cycle the...
- 6
- 326
- 0
De 21 va 22 dap an TOAN on TNTHPT
Ngày tải lên :
15/02/2014, 13:54
... điểm) Học sinh học chương trình l m phần dành riêng cho chương trình 1/ Theo chương trình chuẩn: Câu IV.a : (2,0 điểm) x = − t Trong không gian cho điểm M(1;-2;-1) đường thẳng (d): y = 2t ,(t ... z = + 2t 1/ L p phương trình mặt phẳng (P) qua M vuông g c với (d) 2/ L p phương trình mặt cầu có tâm g c tọa độ tiếp xúc với mặt phẳng (P) CâuV.a : (1,0 điểm) 1/ Giải phương trình: x3 + x ... nghiệm phương trình 2/ Theo chương trình nâng cao: Câu IV.b : (2,0 điểm) Trong không gian cho điểm M(1;1;-2) mặt phẳng (P): 2x + 2y – z + = 1/ Tìm tọa độ điểm M’ đối xứng với M qua mặt phẳng...
- 8
- 341
- 2
Accounting Standard (AS) 22: Accounting for Taxes on Income pdf
Ngày tải lên :
06/03/2014, 15:21
... 58x30%=17 118 (L) 17 Nil 19x30%=6 124 (L) 6 Nil Nil1 124 (L) Nil Nil Nil1 124 (L) Nil Nil Nil1 124 (L) Nil Nil Nil1 124 (L) Nil 10 Nil Nil1 124 (L) Nil 11 294 -79x30%=-24 100 (L) 270 12 295 -84x30%=-25 ... AS 22 (a) has a legally enforceable right to set off the recognised amounts; and (b) intends to settle the asset and the liability on a net basis 28 An enterprise will normally have a legally ... purposes of the recognition of deferred tax asset in respect of loss arising under the head ‘Capital gains’ is normally fulfilled, are sale of an asset giving rise to capital gain (eligible to set-off...
- 24
- 455
- 0
Báo cáo "The effect of Cu concentration in soil and phosphorous fertilizer on plant growth and Cu uptake by Brassia juncea L. grown on contaminated soils " doc
Ngày tải lên :
14/03/2014, 15:20
... high level of Cu concentration 20 10 0 10 20 30 40 50 Cu2+ in soil (ppm) Plant height (cm) Biomass (g/ pot) Cu content in plant (ppm) Fig The relationship between Cu2+ in soil with plant height ... 03931, 2005, European Geosciences Union [2] D.A Cataldo, R.E Wildung, Soil and plant factors influencing on the accumulation of heavy metals by plants, Environmental health Perspectives, 27 (1978) ... Plant samples (leaves and shoots) are collected and washed with pure water and then dried at 70oC until stabilisation of weight The monitoring indicators for plants growth include plant height...
- 5
- 590
- 1
Tạp chí Khoa học và Phát triển 2009: Tập 7, số 3: 225 -231TRƯỜNG ĐẠI HỌC NÔNG NGHIỆP HÀ NỘI.NH H¦ëNG CñA VIÖC Sö DôNG PH¢N VI£N NÐN KÕT HîP VíI CHÕ PHÈM PH¢N BãN L¸ KOMIX §ÕN SINH TR¦ëNG Vμ N¡NG SUÊT GIèNG NG¤ LVN4Effect of Granulated Fertilizer Appl potx
Ngày tải lên :
19/03/2014, 23:20
... kg N + 90 kg P2O5 Bón thúc l n l c ngô - với l ng 50 kg N + 45 kg K2O v bón thúc l n l c ngô - 10 với l ng phân đạm v kali l i Phân đợc bón vo hng rạch sâu cm cách g c ngô cm Nguyn Vn Lc, Nguyn ... phơng pháp bón vãi thông thờng Bảng Thời gian sinh trởng giống ngô LVN4 công thức thí nghiệm Cụng thc bún (CTB) Gieo - Tr c (ngy) Gieo - Tung phn (ngy) Chờnh lch tung phn - phun rõu (ngy) Gieo ... việc sử dụng chế phẩm phân bón đợc tiến hnh trờng Đại học Nông nghiệp H Nội 226 VậT LIệU V PHƯƠNG PHáP NGHIÊN CứU 2.1 Vật liệu nghiên cứu Vật liệu nghiên cứu đề ti l giống ngô lai LVN4, loại phân...
- 7
- 675
- 1
Báo cáo khoa học: Effect of monovalent cations and G-quadruplex structures on the outcome of intramolecular homologous recombination doc
Ngày tải lên :
29/03/2014, 23:20
... (TGGGGC)4 ´ 5´ DSB B C 5´ 3´ 5´ 5´ 3´ 5´ 3´ G4 structure 5´ Slippage loop 5´ 3´ Slippage loop 5´ Fig Recombination model involving G- quadruplex (G4 ) structure and slippage processes for the generation ... phenolextracted, ethanol-precipitated, and used to transform E coli DH5a cells Bacteria were plated onto LB agar plates containing Blue-O-Gal (BRL, Gaithersburg, MD, USA) at 0.3 g L) 1 as lacZ gene ... inclusion of the sequence (TGGGGC)4 in some recombinant molecules Supporting this reasoning are the results found in dimethyl sulfate methylation protection assays carried out with oligonucleotides...
- 11
- 472
- 0
DESIGNING ON SOLID FOUNDATIONS
Ngày tải lên :
03/06/2014, 18:01
... Projects Clients Yourself Others ? Nokia 3310 (worst cellphone ever) Projects Clients Yourself Others The lists GOOD BAD Preparations “The Process Toolbox” ... Toolbox” by Simon Collison http://col.ly/s/794 SPPW (Styled Pixels Per Website) (also referred to as “SHAPOW!”) pixels restaurant time submersion cohesion pleasure book indiscretion pixels restaurant ... Projects Clients Yourself Others Educate What’s a good website? Pricing Project Phases Their job? Approach Projects Clients Yourself Others comfort zone skillset life Job Titles Projects Clients...
- 37
- 146
- 0
Báo cáo hóa học: " Impact of g-chain cytokines on EBV-specific T cell cultures" doc
Ngày tải lên :
18/06/2014, 16:20
... previously described [12] Briefly, target LCL were seeded as replicates in Ubottom 96-well plates at doubling dilution, starting from 104 cells/well to 78 cells/well T cells were added to half of ... peripheral blood mononuclear cells of HLA-typed healthy donors using culture supernatant from the EBVproducing marmoset cell line B95.8 (American Type Culture Collection) Signed informed consent ... namely ad hoc protocols able to appropriately balance the effector cell expansion and the timing of culture Methods Lymphoblastoid cell lines (LCL) EBV-transformed lymphoblastoid cells were generated...
- 8
- 453
- 0
Kiểm tra chất l-ợng ôn thi ĐH - CĐ (Lần 2) Môn: Toán (khối a) pptx
Ngày tải lên :
28/07/2014, 18:20
... −1 ∫3 − t = − ln t + 0,5 − = − ln 2− 2+ 0,25 4π 2− − ln 2+ 1.0 điểm Tìm tọa độ giao điểm A đường thẳng d với mặt phẳng (P ) Viết phương trình đường thẳng Δ qua điểm A vuông g c với d nằm (P ... Do nghiệm phương trình π 7π π k 2π 5π k 2π x = − + k 2π ; x = ;x = + k 2π ; x = + + 6 18 18 b) 0,75 0,25 Giải phương trình log x x − 14 log16 x x3 + 40 log x x = 1 ;x ≠ 16 • Dễ thấy x = nghiệm ... phải đường thẳng x = + L y đối xứng đồ thị (C) bên trái đường thẳng x = qua Ox • • + + + Học sinh tự vẽ hình Dựa vào đồ thị ta có: m < −2 : Phương trình vô nghiệm; m = −2 : Phương trình có nghiệm...
- 5
- 179
- 0
Báo cáo lâm nghiệp: "Modelling of the shape of red heartwood in beech trees (Fagus sylvatica L.) based on external tree characteristics" potx
Ngày tải lên :
07/08/2014, 16:20
... after felling On the inter-disc sections (logs), the seal length (ls), seal width (ws) and moustache length (lm) of branch scars were measured (Fig 2; branch scars were only considered if ls ≥ cm ... dbh (dbh/age); hcb : height of the crown base; hcbrel : height of the crown base related to total tree height; cl: crown length; clrel : crown length related to total tree height; rmeanrel : mean ... study it was suggested that particularly larger knots with a higher inclination, having a large knot occlusion area (ka), and knots with a small (relative) knot depth (kd), situated close to the...
- 9
- 392
- 0
Báo cáo lâm nghiệp: "Efficient method of micropropagation and in vitro rooting of teak (Tectona grandis L.) focusing on large-scale industrial plantations" pptx
Ngày tải lên :
07/08/2014, 16:20
... combination with low concentration of auxin, in rooting medium, was essential in stimulating high rooting percentage with high quality of roots, resulting in fast growing plantlets during acclimatization ... trees – Clonal multiplication of Tectona grandis (teak) by tissue culture, Plant Sci Lett 17 (1980) 259–268 [14] Krishnapillay B., Silviculture and management of teak plantations, in: Unasylva, No ... Murashige and Skoog medium Figure Effect of medium composition on average length of axillary shoots ( ) and callus production at the base of the explants ( ) after one month of culture Values represent...
- 6
- 382
- 0
Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf
Ngày tải lên :
08/08/2014, 01:22
... robur L. , a rhythmically growing species, Trees 12 (1998) 424–430 [2] Aspinall D., Paleg L .G. , Proline accumulation: physiological aspects, in: Paleg L .G. , Aspinall D (Eds.), The Physiology and ... The concentration of proline in embryogenic cultures of larch, sitka spruce and oak is shown in Table I With no proline addition, intracellular proline levels are correspondingly low When proline ... applied Salt can dramatically reduce plant growth The addition of NaCl caused a progressive decline in elongation of shoots of Hordeum vulgare L cv Maris Mink (cultured Barley) as well as a decrease...
- 4
- 338
- 0
.LONGMAN E N G L I S H GRAMMAR PRACTICE for intermediate students L. G. Alexander .Addison Wesley ppsx
Ngày tải lên :
08/08/2014, 09:21
... (Intermediate level) English language Grammar I Title 428.2 Library of Congress Cataloging-in-Publication Data Alexander, L G Longman English gmmmar practice (Intermed~ate level) L G Alexander p cm English ... published 1990 Eleventh impression 1998 Cartoons by Larry, Ed Mclaughlin and David Simonds British Library Cataloguing i n Publication Data Alexander, L G (Louis George) 1932Longman English grammar practice ... English grammar This book is based on the Longman English Grammar and the grammatical information in it is all drawn from this work Longman English Grammar Practice has been designed to stand on...
- 302
- 451
- 0
báo cáo khoa học: " Identification of tissue-specific, abiotic stressresponsive gene expression patterns in wine grape (Vitis vinifera L.) based on curation and mining of large-scale EST data sets" docx
Ngày tải lên :
11/08/2014, 11:20
... fragment the “canonical adaptor region” (5’TTGTAAAACGACGGCCAGTGAATTGTAATACG ACTCACTATAGGGCGAATTGGGTACCGGG CCCCCCCTCGAGGTATAAGCTTGATATCGAAT TCCGTTGCTGTCG-3’), “2variant39” (5’-GCTTGA TATCGAATTCCGTTGCTAATTCCGTTGCTGTCG3’), ... file To detect and mask TGCGA-tagged/NotI/vector regions 3’ to the inserted EST, “pB SK- at NotI site” (5’-TGCGAGCGGCCG CCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTT TAGTGAGGGTTAATTTCGA GCTTGGCGTAATCATGGTCATAGCTGTTTCC-3’) ... (5’-GCTTGA TATCGAATTCCGTTGCTAATTCCGTTGCTGTCG3’), “3variant51” (5’-GCTTGATATCGAATTCCGTTG CTGTCGCCGTTGCTGTCTCCGTTGCTGTCG-3’), and “4variant39” (5’-GCTTGATATCGAATTCCGTT GCTGTCGCCGTTGCTGTCG-3’) sequences...
- 23
- 403
- 0
E8 UNIT3 G-L&READ
Ngày tải lên :
23/10/2014, 09:00
... going to be home late tonight I have to go and visit Grandma after work Nam : What time will you be home? Mrs Vui : I’ll be home after dinner I’m sorry, but you’ll have to cook dinner yourself ... stove Nam : OK Give my love to Grandma Mrs Vui : I will Oh, I almost forgot Can you call Aunt Chi, please? Ask her to meet at Grandma’s house Nam : No problem Bye, Mom Mrs Vui : Bye Monday, September ... HOME GETTING STARTED -LISTEN and READ * Complete the list of the things Nam has to do: - Cook dinner - Go to the market - Buy some fish and vegetables - Call Aunt Chi to meet his mother at Grandma’s...
- 12
- 177
- 0