2 yêu cầu phi chức năng
Báo cáo khoa hoc:" Genetic polymorphisms and susceptibility to lung disease" ppsx
Ngày tải lên :
11/08/2014, 08:20
... Temp °C 58 Primer name Sequence Temp °C p 22 Ex 2F p 22 Ex 2R p 22 Ex 3F p 22 Ex 3R p 22 Ex 4F p 22 Ex 4R p 22 Ex 5F p 22 Ex 5R p 22 Ex 6F p 22 Ex 6R p 22 85A p 22 85G GACCCTGTCACTGTGCTGTG GAGGCAAACAGCTCACTGTG ... DUOX2 Ex24F DUOX2 Ex25R DUOX2 413T DUOX2 413C DUOX2 429 A DUOX2 429 C DUOX2 597-8GG DUOX2 597-8GA DUOX2 597-8CG DUOX2 597-8CA DUOX2 20 48G DUOX2 20 48A DUOX2 3 026 G DUOX2 3 026 A DUOX2 320 0T DUOX2 320 0C ... primers used for DNA amplification and ASOH (Continued) p 22 113T p 22 113C p 22 179A p 22 179C p 22 214C p 22 214T p 22 403G p 22 403A p 22 521 C p 22 521 T GTGGTACTTTGGTGCCT GTGGTACTCTGGTGCCT GAAGAGGAAGAAGGGCT...
- 11
- 440
- 0
Báo cáo khoa học: "Expression and characterization of the flavoprotein domain of gp91phox" potx
Ngày tải lên :
07/08/2014, 14:22
... cytochrome b complex Nature, 1987, 327 (6 124 ), 717 -20 12 Dinauer MC, Pierce EA, Bruns GA, Curnutte JT, Orkin SH Human neutrophil cytochrome b light chain (p 22- phox) Gene structure, chromosomal ... 19 92, 41(6), 1163-8 29 Nakamura M, Sendo S, van Zwieten R, Koga T, Roos D, Kanegasaki S Immunocytochemical discovery of the 22 - to 23 -Kd subunit of cytochrome b558 at the surface of human 26 ... 19 92, 31(10), 27 65-74 51 Uhlinger DJ, Taylor KL, Lambeth JD p67-phox enhances the binding of p47-phox to the human neutrophil respiratory burst oxidase complex J Biol Chem, 1994, 26 9(35), 22 0958...
- 8
- 216
- 0
Báo cáo khoa học: "Activation domain in P67phox regulates the steady state reduction of FAD in gp91phox" pot
Ngày tải lên :
07/08/2014, 14:22
... activity Steady state reduction level Heme (nmol/min/nmol of heme) FAD analog 320 50 21 0 30 28 3% 21 2% 4+1%
- 5
- 240
- 0
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc
Ngày tải lên :
09/08/2014, 10:21
... Exons (n) NCF2 181,791, 321 to 181, 826 ,339 15 NCF4 22 35,586,991 to 35,604,004 10 CYBB X 37, 524 ,26 4 to 37,557,658 13 CYBA 16 87 ,23 7,199 to 87 ,24 4,958 RAC2 22 35,951 ,25 8 to 35,970 ,25 1 Positions ... not for citation purposes) 18 19 20 21 22 23 24 25 26 27 28 29 30 matoid factor with radiographic severity of rheumatoid arthritis Arthritis Res Ther 20 06, 8:R 128 van der Helm-van Mil AH, Verpoort ... blocks in the human genome Science 20 02, 29 6 :22 25 -22 29 37 Purcell S, Daly MJ, Sham PC: WHAP: haplotype-based association analysis Bioinformatics 20 07, 23 :25 5 -25 6 38 The UCSC Genome browser [http://genome.ucsc.edu]...
- 11
- 475
- 0
Báo cáo y học: "DEK binding to class II MHC Y-box sequences is gene- and allele-specific" pptx
Ngày tải lên :
09/08/2014, 01:23
... association the MHC genes J Rheum 1997, 24 :560-567 Available online http://arthritis-research.com/content/5/4/R 226 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Szer IS, Sierakowska H, Szer W: ... 67:749-753 32 Faulkner NE, Hilfinger JM, Markovitz DM: Protein phosphatase 2A (PP2A) activates the HIV -2 promoter through enhancer elements that include the pets site J Biol Chem 20 01, 27 6 :25 804 -25 8 12 ... http://arthritis-research.com/content/5/4/R 226 Figure t (a) x bo x bo an ut m K] ct Y AT DE 1Y x 01 e ext 10 CA s r bo *05 C en Y 1* x is lea A1 bo Competitor QA RA DQ nt uc D Y D [a n ng - 20 20 20 20 (b) x x x x bo...
- 8
- 331
- 0
Báo cáo y học: " Non-imprinted allele-specific DNA methylation on human autosomes" pptx
Ngày tải lên :
09/08/2014, 20:21
... and amplicons C21orf81 HSF2BP RIPK4 CBR1 23 _1 23 _2 2 62 2 32 176_1 176 _2 Length (bp) 370 426 400 24 1 3 02 476 CpG sites 31 26 42 25 31 44 A/C (-) rs 229 724 6 A/C (+) rs5 627 0809 A/G (-) rs2838343 A/G ... 100 60 40 20 0 50 100 DNA methylation [%] 197 22 9 307 158 176_1 176 _2 140 28 3 23 2 22 3 23 _1 26 2_R 23 _2 257 335 187 26 2_L DNA methylation [%] 80 Amplicons Figure Inter-individual variation of DNA ... Allelic methylation levels in amplicon 26 2 Allele G 40 DNA methylation [%] (c) 50 100 DNA methylation [%] 80 60 40 20 20 A/A 30 23 32 15 27 20 11 13 10 22 24 2_ L 28 A from A/G G from A/G G/G Allele...
- 11
- 311
- 0
Báo cáo y học: " Allele-specific copy number analysis of tumor samples with aneuploidy and tumor heterogeneity" ppt
Ngày tải lên :
09/08/2014, 23:20
... 313 353 426 3 5 126 6 520 68 6969 Validated ploidy 1 32 Calculated ploidy 3.7 16080 3 .2 3.4 1 626 6 4.4 4.6 20 1 3 .2 241 2. 3 313 3.7 353 4.1 426 3 5 126 2. 8 6 520 3.1 68 3.9 6969 Figure 2 Additional files ... cn2m0 cn4m2 Allelelic imbalance ratio cn2m0 cn3m0 4m1 cn3m1 cn5m2 cn2m1 Allele frequency Log-ratio Average log-ratio Figure DMs cn1m0 cn4m2 DMs Sample 1 32 16080 1 626 6 20 1 24 1 313 353 426 3 5 126 ... Additional_File_1.pdf, 1302K http://genomebiology.com/imedia/9634398565 925 045/supp1.pdf Additional file 2: Additional_File _2. pdf, 24 02K http://genomebiology.com/imedia/17 727 171845 925 05/supp2.pdf ...
- 29
- 332
- 0
Báo cáo y học: "A single-tube allele specific-polymerase chain reaction to detect T315I resistant mutation in chronic myeloid leukemia patients" pdf
Ngày tải lên :
10/08/2014, 21:23
... Nat Med 20 09, 15:1149-11 52 O’Hare T, Eide CA, Deininger MW: Bcr-Abl kinase domain mutations, drug resistance, and the road to a cure for chronic myeloid leukemia Blood 20 07, 110 :22 42- 224 9 Cang ... Blood 20 06, 108 :23 32- 2338 22 Jabbour E, Kantarjian H, Cortes J: Chronic myeloid leukemia and secondgeneration tyrosine kinase inhibitors: when, how, and which one? Semin Hematol 47:344-353 23 Wei ... mutations (Y253F, Y253H, E255K, M351T, and F359V) (data no shown) For direct sequencing, a “T” peak indicated the presence of T315I which could be clearly seen in 100%, 50%, 25 %, 12. 5%, and 6 .25 % A...
- 7
- 439
- 0
Báo cáo y học: "Analysis of adenovirus trans-complementationmediated gene expression controlled by melanoma-specific TETP promoter in vitro" ppsx
Ngày tải lên :
12/08/2014, 04:20
... receptors J Virol 20 05, 79: 121 25- 121 31 62 Goding CR: Mitf from neural crest to melanoma: signal transduction and transcription in the melanocyte lineage Genes Dev 20 00, 14:17 12- 1 728 63 Young CS: ... interests Received: 27 May 20 10 Accepted: 29 July 20 10 Published: 29 July 20 10 Conclusions In the current study we were able to demonstrate strong in vitro enhancement of eGFP, IL -2 and CD40L transgene ... 20 02, 1: 321 - 328 32 van Beusechem VW, van den Doel PB, Grill J, Pinedo HM, Gerritsen WR: Conditionally replicative adenovirus expressing p53 exhibits enhanced oncolytic potency Cancer Res 20 02, ...
- 17
- 410
- 0
Báo cáo y học: " Intragenic transcriptional cis-activation of the human immunodeficiency virus 1 does not result in allele-specific inhibition of the endogenous gene" pdf
Ngày tải lên :
13/08/2014, 05:21
... Retrovirology 20 08, 5:98 http://www.retrovirology.com/content/5/1/98 chromosome Ch8p21.1 HMBOX1 E2s E3s E3a E1 E1a UGA E4 E1b I2a I2b I2c I2d AUG E4a E11 (+) E4b Ch8: 28 823 741 LTR gag SD UP5 MS2 x24 MS2 ... loop-specific binding to TAR RNA Cell 1998, 92: 451-4 62 http://www.retrovirology.com/content/5/1/98 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Marcello A, Lusic M, Pegoraro ... D, Page 13 of 15 (page number not for citation purposes) Retrovirology 20 08, 5:98 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Romana S, Radford-Weiss I, Gross F, Valensi F, Delabesse E, Macintyre...
- 15
- 329
- 0
PHÂN BIỆT GENOTYPE 1 và 6 BẰNG kỹ THUẬT ALLELE SPECIFIC RT PCR dựa vào VÙNG GEN NS5B của VIRUS VIÊM GAN c
Ngày tải lên :
20/08/2015, 11:28
... 6 /20 13 10 11 12 13 14 15 16 CC34 CC35 CC36 CC151 CC1 52 CC153 CC208 CC179 CC265 113 1a 6a 6e 6e 6a 1b 6e 6p 6e 1b 6 6 6 23 671 24 6 72 25 674 26 818 27 847 28 24 1 29 28 3 30 29 1 31 9 72 32 CC1543 6e ... 19 20 21 22 (2) 141 CC335 CC337 CC484 CC485 670 (3) 1b 6a 6e 1b 1b 6a (4) 6 1 (1) (2) (3) (4) 33 CC1544 6e 34 CC1591 6e 35 CC15 92 1a 36 544 6p 37 567 1b 38 601 1b Y học thực hành (873) - số 6 /20 13 ... Olaechea de Careaga 20 06 Predictive factors for response to treatment of chronic hepatitis C Annals of Hepatology 5(Suppl.1): S24-S28 Michael F Freid et al 20 02 Peginterferon alpha-2a plus ribavirin...
- 4
- 400
- 1
Báo cáo khoa học: Dynamics of a-synuclein aggregation and inhibition of pore-like oligomer development by b-synuclein doc
Ngày tải lên :
23/03/2014, 09:21
... Mallory M & Masliah E (20 01) b-synuclein inhibits alpha-synuclein aggregation: a possible role as an anti-parkinsonian factor Neuron 32, 21 3 22 3 FEBS Journal 27 4 (20 07) 18 62 1877 ª 20 07 The Authors ... JQ (20 04) More than just two peas in a pod: common amyloidogenic 1874 10 15 16 17 18 19 20 21 22 23 properties of tau and alpha-synuclein in neurodegenerative diseases Trends Neurosci 27 , 129 –134 ... Proteins 62, 183–1 92 51 Maiti NC, Apetri MM, Zagorski MG, Carey PR & Anderson VE (20 04) Raman spectroscopic characteriza- FEBS Journal 27 4 (20 07) 18 62 1877 ª 20 07 The Authors Journal compilation ª 20 07...
- 16
- 284
- 0
Nghiên cứu tính đa dạng của allele hla - DQA1 bằng kỹ thuật polymerase chain reaction sequence specific primers (PCR - SSP) ở dân tộc kinh miền trung - Việt Nam docx
Ngày tải lên :
25/03/2014, 03:22
... tìm thấy ( 328 ) 75 62 96 24 24 22 III Bàn luận Cho đến nay, hệ kháng nguyên bạch cầu ngời (HLA) đợc coi hệ kháng nguyên di truyền phức tạp đa dạng 48 Tần suất kháng nguyên (%) 0.35 0 .29 0.04 0.45 ... Rad Gel Doc 20 00 Bảng 2: Tần suất allele HLA - DQA1 ngời Kinh Việt Nam TT 10 Tên gọi allele DQA1 * 0101/4 DQA1 * 01 02/ 4 DQA1 * 01 02/ 3 DQA1 * 0103 DQA1 * 020 1 DQA1 * 0301 DQA1 * 03 02 DQA1 * 0401 ... DQA1 * 01 02/ 4 A * 5' 02 + A * 3'01 DQA1 *0101, DQA1*01 02, DQA1*0104 DQA1 * 01 02/ 3 A * 5'03 + A * 3'01 DQA1 *0101, DQA1*0103 DQA1 * 0103 A * 5'04 + A * 3' 02 149bp DQA1 *0103 DQA1 * 020 1 A * 5'04...
- 5
- 622
- 0
báo cáo hóa học:" Whole blood assessment of antigen specific cellular immune response by real time quantitative PCR: a versatile monitoring and discovery tool" potx
Ngày tải lên :
18/06/2014, 15:20
... PCR J Immunol Methods 20 03, 27 6:69-77 Page of (page number not for citation purposes) Journal of Translational Medicine 20 08, 6:58 15 16 17 18 19 20 21 22 23 24 25 26 27 28 http://www.translational-medicine.com/content/6/1/58 ... b-actin 1.0E-01 1.0E- 02 1.0E-03 p = 0.04 1.0E- 02 p = 0.05 1.0E-03 p = 0.04 p = 0.01 1.0E-04 1.0E-04 14 28 42 56 70 84 days post-vaccination 98 1 12 126 14 28 42 56 70 84 98 1 12 126 days post-vaccination ... monitoring Immunol Rev 20 03, 196 :24 7 -26 4 Keilholz U, Martus P, Scheibenbogen C: Immune monitoring of Tcell responses in cancer vaccine development Clin Cancer Res 20 06, 12: 2346s -23 52s Britten CM, Janetzki...
- 9
- 438
- 0
Báo cáo hóa học: "Prognostic Impact of MiR-155 in Non-Small Cell Lung Cancer Evaluated by in Situ Hybridization" pot
Ngày tải lên :
18/06/2014, 16:20
... Wedge* 24 3 73 190 61 Pneumonectomy 92 27 37 47 I 157 47 190 71 II 136 41 61 51 IIIa 42 12 17 23 85 188 25 56 190 84 74 57 62 19 25 36 23 2 69 190 66 76 23 35 43 27 18 18 307 28 92 190 47 58 47 No 28 4 ... al Journal of Translational Medicine 20 11, 9:6 http://www.translational-medicine.com/content/9/1/6 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Kluiver J, Poppema S, de JD, ... 53 NR 60 Female 82 25 190 63 Male 25 3 75 83 56 Never 15 19 43 Current 21 5 64 NR 60 Former 105 31 71 54 197 59 NR 63 ECOG 120 36 64 52 ECOG 18 25 33 10% 32 10 98 57 191 95...
- 9
- 662
- 0
báo cáo hóa học:" Transcriptional regulation of bone formation by the osteoblast-specific transcription factor Osx Chi Zhang" pptx
Ngày tải lên :
20/06/2014, 04:20
... Research 20 10, 5:37 http://www.josr-online.com/content/5/1/37 27 28 29 30 31 32 33 34 35 36 expression via interaction with antioxidant-responsive element in bone cells J Biol Chem 20 07, 28 2 :22 0 52- 220 61 ... J Biol Chem 20 00, 27 5 :25 163 -25 1 72 22 Nishio Y, Dong Y, Paris M, O'Keefe RJ, Schwarz EM, Drissi H: Runx2mediated regulation of the zinc finger Osterix/Sp7 gene Gene 20 06, 3 72: 62- 70 23 Celil AB, ... target of Runx2, the results of this study indicated that Osx expression was still induced by BMP -2 treatment in Runx2 null cells but not induced by Runx2 overexpression in C2C 12 cells Regulatory...
- 8
- 491
- 0
báo cáo hóa học:" How do existing HIV-specific instruments measure up? Evaluating the ability of instruments to describe disability experienced by adults living with HIV" pot
Ngày tải lên :
20/06/2014, 16:20
... of the pilot version Soc Sci Med 20 03, 57(7): 125 9- 127 5 35 Pakenham KI, Rinaldis M: Development of the HIV/AIDS Stress Scale Psychology & Health 20 02, 17 (2) :20 3 -21 9 36 Nixon S, Cott C: Shifting ... with HIV infection? AIDS Care 20 09, 21 (3): 322 - 328 10 Kiser AK, Pronovost PJ: Management of Diseases Without Current Treatment Options Something Can Be Done JAMA 20 09, 301(16):1708-1709 11 Weiss ... Association 20 02 21 McCormick WC, Inui TS, Deyo RA, Wood RW: Long-term care needs of hospitalized persons with AIDS: a prospective cohort study J Gen Intern Med 1991, 6(1) :27 -34 22 O’Dell MW,...
- 10
- 553
- 0
Báo cáo hóa học: " Chromosomal 16p microdeletion in Rubinstein-Taybi syndrome detected by oligonucleotide-based array comparative genomic hybridization: a case report" doc
Ngày tải lên :
21/06/2014, 19:20
... Genet 20 10, 19:43-49 11 Chen B, Piel WH, Gui L, Bruford E, Monteiro A: The HSP90 family of genes in the human genome: insights into their divergence and evolution Genomics 20 05, 86: 627 -637 12 Bartsch ... global developmental delay, dysmorphic features and multiple congenital anomalies, carrying a 120 kb microdeletion of chromosome 16p13.3 detected by array-CGH (Figure 2) The deletion region encompasses ... Molecular analysis of the CBP gene in 60 patients with Rubinstein–Taybi syndrome J Med Genet 20 02, 39:416- 421 Bartsch O, Schmidt S, Richter M, Morlot S, Seemanová E, Wiebe G, Rasi S: DNA sequencing...
- 19
- 215
- 0