2 in a flat major

wiley philanthropy in a flat world phần 2 doc

Ngày tải lên : 09/08/2014, 20:20

... small to a size tiny.” We are communicating, travelling, collaborating, exchanging information, thinking, and working together with people all over the world in a completely new way In a way ... existed If you are a fundraiser and you have a link to the Internet, you are potentially an international NGO 19 FLAT AND BEAUTIFUL Individuals are now in a position where they can make a difference ... virtual networks of likeminded individuals around the world Geography has been replaced by biography And these individuals are creating organizations They are enabling, empowering, and collaborating...

23
264
0

Evaluating Variables in a Flat File

Ngày tải lên : 05/10/2013, 08:51

... 1 82 CHAPTER 26 ■ EVALUATING VARIABLES IN A FLAT FILE If you no longer need this account, please let us know so we can remove it System Administration Note in particular the shell variables ... is run and the message is sent Likewise, each escape sequence \\ evaluates to a single backslash that causes the following special character to be escaped so that it is treated as plain text ... processes each line of the file using the eval statement, which causes the variables to be replaced with their string values The expanded line is assigned to the variable place_holder so that it can...

2
272
0

wiley philanthropy in a flat world phần 1 pdf

Ngày tải lên : 09/08/2014, 20:20

... Philanthropy in a Flat World Introduction The First Flat World Fundraiser I t was a hot Saturday in August A day to be etched forever in the minds of millions The day that a black pastor from Atlanta, ... First Flat World Fundraiser PART ONE: FLAT AND BEAUTIFUL The Flat World From Columbus to Skinny Lattés Flat, Wild, and Wacky 10 From Geography to Biography 16 Zoom 28 What Makes a Pancake? 31 ... information on fundraising, charitable giving, and related subjects The Association of Fundraising Professionals (AFP) and Wiley each bring to this innovative collaboration unique and important...

24
332
0

wiley philanthropy in a flat world phần 3 pps

Ngày tải lên : 09/08/2014, 20:20

... ofﬁces of European, North American, and Japanese companies As Dinakar Singh, a Wall Street hedge fund manager, remarks in The World Is Flat, “India had no resources and no infrastructure It produced ... small village about 50 kilometers outside of Bratislava in what is now called Slovakia, but back then was part of Czechoslovakia What was brutal during Soviet times was that growing up it became ... importance of 49 FLAT AND BEAUTIFUL retraining, reskilling, and re-equipping people for the challenges that lie ahead is our failing In my 20 08 Philanthropy and Development class at St Mary’s...

23
230
0

wiley philanthropy in a flat world phần 4 ppsx

Ngày tải lên : 09/08/2014, 20:20

... Sarah” This was a personalized e-mail A friendly e-mail So I clicked Two minutes later I was back on my spreadsheet having sponsored Sarah and made an online donation Would I have made a donation ... was created in 20 03 (see Exhibit 2. 1) A total revolution in giving, it simply allows any individual to go online and within a matter of minutes create a personalized home page with a built -in ... required information submissions by nonproﬁts in order to make them available to the public through the Web Financial information is available for all to see, and a search and rating system has been...

23
264
0

wiley philanthropy in a flat world phần 5 pot

Ngày tải lên : 09/08/2014, 20:20

... self-esteem-destroying images that adorn fashion magazines—and Dove’s sales were rising My instant reaction of outrage at a multinational trampling all over 88 The Realities of the Flat World our values to increase ... with: Mark Steyn, writing in the National Review (October 25 , 20 04), related a story from the London Arabic newspaper Al-Quds al-Arabi about a panic that broke out in Khartoum, Sudan, after a crazy ... horizontal collaboration as a way of adding value to our organizations This new way of thinking and working is possible only because the ﬂat world is constantly pushing back boundaries and allowing...

23
258
0

wiley philanthropy in a flat world phần 6 doc

Ngày tải lên : 09/08/2014, 20:20

... believe that we can gain a deeper understanding of the African situation by learning from some of Thomas Friedman’s work Development and Flatness In The World Is Flat, Friedman argues that there are ... people innovating and collaborating Third, you need strong governance both on a local and on a national level to ensure that individuals have a stable playing ﬁeld from which to innovate and develop ... after a chemical leak Six years later, in early summer 20 07, after a mammoth cleaning-up operation, the foundation stone was laid for a brand-new cancer research and treatment center—the Canceropole...

23
199
0

wiley philanthropy in a flat world phần 7 doc

Ngày tải lên : 09/08/2014, 20:20

... your printed boarding pass at the gate Now let’s imagine a typical airline journey 10 years ago.You called the airline, and talked to a human being who looked at availability and reserved your ... But actually, 129 SURVIVING AND THRIVING what it is doing is allowing the airlines to pass you the buck In a way, it is almost allowing them to make you an unpaid employee! Today you are doing ... Publicis advertising agency Many nonproﬁts around the world have already begun the rationalization process For instance, not many 127 SURVIVING AND THRIVING organizations have internalized their call...

23
204
0

wiley philanthropy in a flat world phần 8 docx

Ngày tải lên : 09/08/2014, 20:20

... organization that people want to be associated with, or again, are you the organizational equivalent of the boring guy who talks at you at parties and whom you can’t get away from? What does ... is unstable, sinking, about to be hit by lightning, in an earthquake zone, or in the path of an oncoming fast-moving and heavy object In short, make them realize that the cost of not changing is ... is a closely guarded secret This is why Brian is at an advantage His trace is visible, so it can be analyzed and improved The traces that nonproﬁt organizations leave behind in the hearts and...

23
272
0

wiley philanthropy in a flat world phần 9 docx

Ngày tải lên : 09/08/2014, 20:20

... objectives, getting out there, and making the difference! Interestingly, while talking about change and engaging donors, the Harvard Business Review published in August 20 02 a paper linking the strength ... balance stay the same while globalization and the flat philanthropic world shift boundaries and playing fields around asking, giving, and receiving? The way money comes into organizations today ... donors in a much clearer and more powerful way than in the past Brand will always be important, and as we saw after the tsunami, it was the leading nonprofit organization brands (the Red Cross at...

23
165
0

wiley philanthropy in a flat world phần 10 pdf

Ngày tải lên : 09/08/2014, 20:20

... 1 02 107 Airlines, rationalization by, 128 –130 Amazon, 52 Amnesty International, 105, 135 Andressen, Katya, 141, 144 Apple Inc., 26 , 27 Association for Cancer Research (ARC), 25 26 Attracting donors, ... start over We are not building capacity in a sustainable way I believe that we have turned fundraising from a sustainable source of income into an unsustainable source that is a perpetual challenge ... training on inspiration, motivation, and creativity in fundraising practice and theory Contact Jon by e-mail: jon@bethechange.fr 21 1 Index Addis, Benyam, 21 , 104 Africa, globalization and, 1 02 107...

31
244
0

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Ngày tải lên : 25/10/2012, 10:31

... multivariate Cox model In a large trauma cohort study [22 ], Ang2 correlated with mortality in a univariate analysis In a surgical population with ARDS, Ang -2 predicted death with a similar discriminatory ... of Ang -2 as a biomarker in critically ill patients are warranted Key messages • Excess Ang -2 was independently associated with inferior survival • Ang -2 concentrations are increasingly higher across ... statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang -2 (Table 2) ...

9
634
0

Chapter 2: Pressure Distribution in a Fluid

Ngày tải lên : 23/10/2013, 21:15

... P/16 = 22 2/16 14 lbf Ans 2. 21 In Fig P2 .21 all fluids are at 20 C Gage A reads 350 kPa absolute Determine (a) the height h in cm; and (b) the reading of gage B in kPa absolute Solution: Apply ... = 25 1000 Pa 25 1 kPa Ans (b) 2. 22 The fuel gage for an auto gas tank reads proportional to the bottom gage pressure as in Fig P2 .22 If the tank accidentally contains cm of water plus gasoline, ... dz B x B Ans 2. 5 Atlanta, Georgia, has an average altitude of 1100 ft On a U.S standard day, pressure gage A reads 93 kPa and gage B reads 105 kPa Express these readings in gage or vacuum pressure,...

44
626
1

Tài liệu Module 2: Updating Data in a Database doc

Ngày tải lên : 21/12/2013, 19:15

... 0&%'.-9:'.-9 9A, < .23 44.-9 9A, ' -9?,)'.-91.9 +23 44.-91.9+443'' ... #$%&'("!)"*+%,-./0"1,-,"./","1,- ,2, 3(" " =S" ! B ,A. /0"G$5H"9(3&'-3"-$","7(E"#.65$3$I-"X66(33"1,- ,2, 3(" B'.%("D2J(6- .A( " !"#38",#8",#1"#3*&)#-"%.# %)3/013#1"#*#+),#L '2% "3"-1# I 22) 33#(*1*4*3)6# ?(,%K./" @"/ #2* +#3*&)#-"%.#%)3/013#1"# ... #$%&'("!)"*+%,-./0"1,-,"./","1,- ,2, 3(" ! ? ,2" !R=)"B ,A. /0"G$5H"9(3&'-3" B'.%("D2J(6- .A( " !"#'+1%"( /2) #18)#0*46# ?(,%K./" 7+#18'3#0*49#:"/#,'00 #2% )*1)#*# -"%.#*+(#3*&)#18)#-"%.# %)3/013#1"#*#+),#I 22) 33# (*1*4*3)6#...

40
444
0

Tài liệu Modifying Rows in a DataTable phần 2 docx

Ngày tải lên : 24/12/2013, 01:17

... DisplayDataRow() is defined as follows: public static void DisplayDataRow( DataRow myDataRow, DataTable myDataTable) { Console.WriteLine("\nIn DisplayDataRow()"); foreach (DataColumn myDataColumn ... myNewDataRow at various points The output from AddDataRow() and its call to DisplayDataRow() is as follows: In AddDataRow() Calling myDataTable.NewRow() myNewDataRow.RowState = Detached Calling myDataTable.Rows.Add() ... locate the DataRow // in the DataTable using the primary key value DataRow myEditDataRow = myDataTable.Rows.Find("J5COM"); // step 3: change the DataColumn values of the DataRow myEditDataRow["CompanyName"]...

7
391
1

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Ngày tải lên : 19/02/2014, 06:20

... FEBS Y Zhang et al naya OA, Kolpakov FA et al (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26 , 3 62 367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, ... 422 4– 422 9 42 Shibahara S, Yoshida T & Kikuchi G (1978) Induction of heme oxygenase by hemin in cultured pig alveolar macrophages Arch Biochem Biophys 188, 24 3 25 0 43 Okinaga S, Takahashi K, Takeda ... kit (Amersham Biosciences, Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic...

12
621
0

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-speciﬁc isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Ngày tải lên : 21/02/2014, 15:20

... CK 2a in gel ﬁltration assay rabbit anti-(human CK 2a) polyclonal IgG was used Alkaline-phosphataseconjugated anti-(rabbit IgG) Ig (Sigma, St Louis, MI, USA) was used as a secondary reagent Samples ... of interaction Filter b-galactosidase assay Growth on His– medium b-Galactosidase activity (Miller units) CK 2a( BD): CK2btes(AD**) CK 2a( BD): CK2b(AD**) CK 2a( BD): CK 2a( AD) CK 2a( BD): (AD**) CK2b(BD*): ... Western analyses with polyclonal anti-(b-galactosidase) Ig (ICN Pharmaceuticals inc., Costa Mesa, CA, USA) CA, USA) were performed according to the Stratagene protocols Drosophila CK 2a and CK2btes...

10
464
0

Long-term Exposure to Traffic-related Air Pollution and Type 2 Diabetes Prevalence in a Cross-sectional Screening-study in the Netherlands pdf

Ngày tải lên : 06/03/2014, 19:20

... total traffic per 24 hours on all roads within a 25 0 m circular buffer around the address All GIS calculations were conducted using ArcInfo (ESRI, Redlands, CA) Statistical analyses Participants ... selection bias was minimized by inviting all 50- to 75-year-old inhabitants of the study area to participate and non-response was low (20 %) [ 12] In general, type diabetes remains Dijkema et al Environmental ... spatial contrasts in NO2 over time Occup Environ Med 20 11 28 Kadata: Address Coordinates Netherlands (ACN) - Quality survey 20 00 [Adres Coordinaten Nederland (ACN) - Kwaliteitsonderzoek 20 00] Apeldoorn,...

9
771
0

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Ngày tải lên : 16/03/2014, 16:20

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC ... ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG...

12
512
0