2 c plates — longitudinal performance qualification

Tài liệu 2004 ASME BOILER & PRESSURE VESSEL CODE docx

Tài liệu 2004 ASME BOILER & PRESSURE VESSEL CODE docx

... Subsection NB Class Components Subsection NC Class Components Subsection ND Class Components Subsection NE Class MC Components Subsection NF Supports Subsection NG Core Support Structures ... (15.9) 18 UNF 11 UNC 84 (114.0) 74 (100.0) ⁄4 (19.0) ⁄4 (19.0) 16 UNF 10 UNC 147 (20 0.0) 1 32 (180.0) ⁄8 (22 .2) ⁄8 (22 .2) 14 UNF UNC 23 4 ( 320 .0) 21 2 (28 5.0) (25 .4) (25 .4) 12 UNF UNC 348 (470.0) 318 ... Virginia W K Brigham New Hampshire D E Burns Nebraska J H Burpee Maine C Castle Nova Scotia, Canada R R Cate Louisiana D C Cook California R A Coomes Kentucky D Eastman Newfoundland...

Ngày tải lên: 19/01/2014, 21:20

309 2K 9
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

... Vederas, J .C & Stiles, M.E (1994) Chemical and genetic characterization of bacteriocins produced by Carnobacterium piscicola LV17B J Biol Chem 26 9, 122 04– 122 11 20 Simon, L., Fremaux, C. , Cenatiempo, ... [30], 1 3C HSQC, 1 3C HSQC-NOESY [31] and a 2D NOESY spectrum were recorded at 35 C 15N HSQC, 15 N HSQC-NOESY, HNHA [ 32 34], 1 3C HSQC and 13 C HSQC-NOESY spectra were recorded at 20 C 15N HSQC-NOESY ... & Coventry, M.J (1996) Characterization of the chemical and antimicrobial properties of piscicolin 126 , a bacteriocin produced by Carnobacterium piscicola JG 126 Appl Environ Microbiol 62, 28 97 29 03...

Ngày tải lên: 07/03/2014, 15:20

9 520 0
Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

Báo cáo y học: "Proton-pump inhibitors are associated with a reduced risk for bleeding and perforated gastroduodenal ulcers attributable to non-steroidal anti-inflammatory drugs: a nested case-control study" pptx

... inhibitors 24 (23 .1) 32 (11.3) 2. 36 1. 32 4 .25 0.003 Digoxin (7.8) 11 (3.9) 2. 09 0. 82 5.35 0. 12 Beta-blockers 22 (21 .2) 64 (22 .5) 0. 92 0.53–1.59 0.77 Nitrates (7.7) 26 (9 .2) 0.83 0.36–1.89 0.65 Cardiovascular ... Heart failure 26 (25 .0) 32 (11.3) 2. 63 1.48–4.67 0.001 COPD 25 (24 .0) 57 (20 .1) 1 .26 0.74 2. 15 0.40 Myocardial infarction 20 (19 .2) 32 (11.3) 1.88 1. 02 3.45 0.04 Stroke 18 (17.3) 28 (9.9) 1.91 ... 0.0 02 Melaena 65 ( 62. 5) Coumarin 2. 38 1.03–5.48 0.04 Haematemesis 28 (26 .9) Heart failure 2. 10 1.04–4 .21 0.04 Perforation 12 (11.5) Acetaminophen 2. 47 1.39–4.39 0.0 02 Stomach pain 21 (20 .2) Low-molecular-mass...

Ngày tải lên: 09/08/2014, 10:20

8 459 0
Báo cáo y học: "κ The roles of the classical and alternative nuclear factor-κB pathways: potential implications for autoimmunity and rheumatoid arthritis" ppsx

Báo cáo y học: "κ The roles of the classical and alternative nuclear factor-κB pathways: potential implications for autoimmunity and rheumatoid arthritis" ppsx

... 9, and 13 and prevents cartilage destruction during chronic reactivated streptococcal cell wall-induced arthritis Arthritis Rheum 20 05, 52: 323 9- 324 7 104 Roark CL, French JD, Taylor MA, Bendele ... 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Hayden MS, Ghosh S: Signaling to NF-kappaB Genes Dev 20 04, 18 :21 95 -22 24 Bonizzi G, Karin M: The two NF-kappaB activation pathways and their ... Walsh MC, Speirs KM, Chiffoleau E, King CG, Hancock WW, Caamano JH, Hunter CA, Scott P, Turka LA, Choi Y: TRAF6 is a critical factor for dendritic cell maturation and development Immunity 20 03,...

Ngày tải lên: 09/08/2014, 10:23

14 317 0
Guide to Design Criteria for Bolted and Riveted Joints

Guide to Design Criteria for Bolted and Riveted Joints

... 12. 2 Effect of Type of Coating on Short-Duration Slip Resistance, 198 12. 2.1 Hot-Dip Galvanizing, 198 12. 2 .2 Metallizing, 20 2 12. 2.3 Zinc-Rich Paints, 20 2 12. 2.4 Vinyl-Treated Surfaces, 20 6 12. 3 ... Introduction, 28 9 18 .2 Classification of Beam-to-Column Connections, 29 0 18.3 Behavior of Beam-to-Column Connections, 29 2 18.3 Flexible Beam-to-Column Connections, 29 3 18.3 .2 Semi-Rigid Connections, ... Tension-Type Connections, 27 2 Analysis of Prying Action, 27 4 26 3 xvi Contents 17.6 Design Recommendations, 28 2 17.6.1 Static Loading, 28 2 17.6 .2 Repeated Loading, 28 6 18 Beam-to-Column Connections 28 9...

Ngày tải lên: 24/10/2013, 04:15

352 562 1
aisc design criteria for bolted and riveted joints

aisc design criteria for bolted and riveted joints

... 12. 2 Effect of Type of Coating on Short-Duration Slip Resistance, 198 12. 2.1 Hot-Dip Galvanizing, 198 12. 2 .2 Metallizing, 20 2 12. 2.3 Zinc-Rich Paints, 20 2 12. 2.4 Vinyl-Treated Surfaces, 20 6 12. 3 ... Introduction, 28 9 18 .2 Classification of Beam-to-Column Connections, 29 0 18.3 Behavior of Beam-to-Column Connections, 29 2 18.3 Flexible Beam-to-Column Connections, 29 3 18.3 .2 Semi-Rigid Connections, ... Tension-Type Connections, 27 2 Analysis of Prying Action, 27 4 26 3 xvi Contents 17.6 Design Recommendations, 28 2 17.6.1 Static Loading, 28 2 17.6 .2 Repeated Loading, 28 6 18 Beam-to-Column Connections 28 9...

Ngày tải lên: 24/10/2014, 08:16

352 513 0
Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx

Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx

... ETB1 32 ETB204 ETB307 ETB93 M1–S443 Q2–S443 E27–S443 E27 C1 31 E27–P168 E27–V203 E27–G306 M1 32 S443 A204–S443 M307–S443 P93–V203 50.7 52. 5 49.5 14.4 18.5 22 .2 34.1 38.6 30.8 18.8 15.3 x x x x x ... Discussion The high-level production of GPCRs in conventional in vivo systems such as E coli or Pichia pastoris cells can be very difficult and inefficient Successful approaches require the construction ... mixed with 25 lL of 1% sodium deoxycholate, and incubated for 15 at 25 C Then, mL of 12% icecold trichloroacetic acid was added, and the mixture was centrifuged at 10 000 g for 20 at C (Eppendorf...

Ngày tải lên: 16/03/2014, 10:20

13 434 0
English for Tourism and Hospitality 1

English for Tourism and Hospitality 1

... _speaking Jumbled sentences - Asking someone to wait on the phone Rewrite the sentences with the words in the correct order After you have checked your answers, read each sentence out loud please ... sure Language Point Complete the following sentences Use the models on the previous page to introduce yourself on the phone After you have checked your answers, read each sentence out loud Good ... EXERCISES Key vocabulary Look up the meaning and pronunciation of these words in your dictionary reservation book cost single certainly per night arrive just leave...

Ngày tải lên: 05/11/2012, 09:52

2 2,9K 63
English for Tourism and Hospitality 1

English for Tourism and Hospitality 1

... the 25 th to the 28 th of September (Từ ngày 25 đến ngày 28 tháng Chín.) Leo: Arriving on the 25 th of September and leaving on the 28 th? Three nights? (T c cô tới vào ngày 25 tháng Chín, rời khách ... name, Ms White? (C n cha c tên thưa c White?) Chúng ta nên để ý c ch xưng hô thêm lần Nếu tự xưng "Doctor" (Tiến sĩ hay B c sĩ) "Professor" (Giáo sư) với bạn, bạn gọi họ ch c vị (h c vị) thay dùng ... you like three? Certainly Certainly Just a minute please Thưa quí bạn, Tiếng Anh Cho Ngành Du Lịch loạt Dịch Vụ Giáo D c Đa Văn Hóa Dành Cho Người Trưởng Thành biên soạn, tổ ch c chuyên giảng dạy...

Ngày tải lên: 05/11/2012, 16:27

7 1K 5
Tài liệu SECTION TWO: Structure and Written Expression (1) ppt

Tài liệu SECTION TWO: Structure and Written Expression (1) ppt

... Lieu Du Hoc at www.tailieuduhoc.org Answer Keys A A D D B D C D B 10 B 11 B 12 B 13 B 14 C 15 B 16 A 17 D 18 A 19 D 20 A 21 A 22 A 23 D 24 A 25 B 26 B 27 D 28 B 29 B 30 C 31 A 32 B 33 D 34 C 35 A ... the way ancient soldiers used to carry their swords (C) (D) 37 Most 911 ambulances can arrive at the scene of an accident within minutes of their (A) (B) occurrence, depending on the precision of ... Since recent (B) Because of recent (C) Recent (D) The result of recent 11 The terms of the Treaty of Versailles included that would effectively force Germany to compensate for the loss inflicted...

Ngày tải lên: 26/12/2013, 00:17

6 1,8K 42
Tài liệu A resource for reading and words part 1 ppt

Tài liệu A resource for reading and words part 1 ppt

... fall To step out: To walk out Porch: Veranda, covered entrance Sight: View, spectacle Gate: Entrance, door Incredible: Unbelievable ^ EXERCISES Complete the sentences with a suitable form of the ... the base checking that all the daily tasks have been completed for signs of damage and only store those in perfect condition in paper sacks in a cool, dark place In alternate weeks the auction ... I watched people concealing their faces behind newspaper They rarely conversed with each other, occasionally lifting their eyebrows to look at their fellow passengers But when I started a conversation...

Ngày tải lên: 25/01/2014, 22:20

15 716 3
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; ... Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained ... The gene for Ab(L1– 42) was then produced by PCR using the primers Abstart and Ab42stop (5¢-CCTG CCGAGCTCCTATTAAGCGATCACAACGCCACCAA CCATCAG-3¢) and a sequence-verified plasmid carrying the Ab(L1–40)...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... immunodeficiency virus/acquired immunodeficiency syndrome SOURCES: 1(CDC, 20 09b), 2( CDC, 20 09d), 3(Lin et al., 20 07b), 4(Hagan et al., 20 06), (CDC, 20 08b), 6(Ward, 20 08a) The annual costs of HBV and HCV ... Disease Surveillance 35 BOX 2- 2 CDC Acute Hepatitis B Case Definition 41 BOX 2- 3 CDC Acute Hepatitis C Case Definition 42 BOX 2- 4 CDC Chronic Hepatitis B Case Definition ... hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Key characteristics...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... Recommendations, 2 1 Role of Disease Surveillance, 42 2 2 CDC Acute Hepatitis B Case Definition, 48 2 3 CDC Acute Hepatitis C Case Definition, 49 2 4 CDC Chronic Hepatitis B Case Definition, 52 ... hepatitis C virus; HIV/AIDS, human immunodeficiency virus/acquired immunodeficiency syndrome SOURCES: aCDC, 20 09b; bCDC, 20 09d; cLin et al., 20 07; dHagan et al., 20 06; eCDC, 20 08b; fWard, 20 08a Prevalencea,b ... unvaccinated children and adolescents—has resulted in a dramatic reduction in chronic HBV infection in infants and acute HBV infection in children of all ethnicities (CDC, 20 04; Mast et al., 20 05,...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
Báo cáo khóa học: ICAM-1 expression is highly NF-jB-dependent in A549 cells No role for ERK and p38 MAPK docx

Báo cáo khóa học: ICAM-1 expression is highly NF-jB-dependent in A549 cells No role for ERK and p38 MAPK docx

... described previously [17] Primer pairs for ICAM-1 (Accession No: BC015969) (5¢fi3¢) were (forward) CCG TGT ACT GGA CTC CAG AA, (reverse) AGG TGT AGC TGC ATG GCA TA Cycling parameters for ICAM-1 ... 18934–18940 12 Chen, B .C & Lin, W.W (20 01) PKC- and ERK-dependent activation of IkappaB kinase by lipopolysaccharide in macrophages: enhancement by P2Y receptor-mediated CaMK activation Br J Pharmacol ... of U0 126 , its analogs, and cyclization products Bioorg Med Chem Lett 8, 28 39 28 44 27 Tang, M.L & Fiscus, L .C (20 01) Important roles for 1-selectin and ICAM-1 in the development of allergic airway...

Ngày tải lên: 07/03/2014, 15:20

7 379 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

... HumanCPT1Bmut–pBSSK+ were used as templates The primers used were DH973 (5¢-CAGTGACCCCAGAC GGGGTCGACTTC-3¢) and DH974 (5¢-GGCTGGTCGTC GCCTCGGCAACAGCGGGTTCCTCCTTC-3¢) for pig CPT1B, and DH977 (5¢-CGGTGACCCCAGAAGGGGT ... PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The PCR reaction yielded a 422 -bp product, in which an EcoRI ... pBSSK+ [23 ] To obtain D18PigCPT1B and D28PigCPT1B, deletion primers DH671 (5¢-AGCTGAATTCATGGTCGACTTCAGGCTC AGC-3¢) and DH7 62 (5¢-AGCTGAATTCATGAAACATA TCTACCTGTCCGGG-3¢) were used in combination...

Ngày tải lên: 16/03/2014, 04:20

9 551 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... effective in the reduction of new HBV infections CDC’s Advisory Committee on Immunization Practices (ACIP), which provides recommendations on the control of vaccine-preventable diseases, recommended ... should expand services to reduce the harm caused by chronic hepatitis B and hepatitis C The services should include testing to detect infection, counseling to reduce alcohol use and secondary transmission, ... the CDC develop specific agreements with all state and territorial health departments to support core surveillance for acute and chronic hepatitis B and hepatitis C, and conduct targeted active...

Ngày tải lên: 22/03/2014, 17:20

4 405 1
Báo cáo khoa học: Colocalization of insulin receptor and insulin receptor substrate-1 to caveolae in primary human adipocytes Cholesterol depletion blocks insulin signalling for metabolic and mitogenic control doc

Báo cáo khoa học: Colocalization of insulin receptor and insulin receptor substrate-1 to caveolae in primary human adipocytes Cholesterol depletion blocks insulin signalling for metabolic and mitogenic control doc

... per ml) was mixed with 20 0 lL of buffer (137 mM NaCl, 2. 7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.5) containing lg of empty vector pcis2, pcis2-myc-caveolin-1, or pcis2-HA-IRS1 (kindly supplied ... fluorescence microscopy (Nikon, D-Eclipse CI confocal microscope, Tokyo, Japan) No labelling was observed in the absence of the primary antibody, nor was any cross-reactivity detected between secondary ... per ml, cells were incubated in Krebs–Ringer solution (0. 12 M NaCl, 4.7 mM KCl, 2. 5 mM CaCl2, 1 .2 mM MgSO4, 1 .2 mM KH2PO4) containing 20 mM Hepes, pH 7.40, 1% (w/v) fatty acid-free bovine serum...

Ngày tải lên: 23/03/2014, 12:20

9 424 0
Báo cáo khoa học: "Reduced n-gram models for English and Chinese corpora" ppt

Báo cáo khoa học: "Reduced n-gram models for English and Chinese corpora" ppt

... and Smith (20 05) have investigated a reduced n-gram model for the Chinese TREC corpus of the Linguistic Data Consortium (LDC) (http://www.ldc.upenn.edu/), catalog no LDC2000T 52 Reduced N-Grams ... Freq Token Freq Token 4 ,27 3 Mr 2, 268 he said 1 ,23 1 terms weren’t disclosed the company said 2, 469 but 2, 0 52 he says 709 2, 422 and 1,945 but the 664 as previously reported 2, 144 the 1,503 but Mr ... 7-grams Reduced Model %Improvement of Reduced Model on baseline Trigrams Model size reduction 24 23 1,4 42. 99 399.61 24 0. 52 2 02. 59 194.06 191.91 191 .23 23 0.46 4.18% 11.01 Table Reduced perplexities...

Ngày tải lên: 23/03/2014, 18:20

7 273 0
w