Ngày tải lên: 04/10/2012, 10:02
... 79 million dollars in research funding, diarrhoea 60 million dollars in research funding, malaria 50 million dollars and TB 20 million dollars in research funding In conclusion it is clear that ... seen that the amount of research funding in many cases did not correlate with the seriousness of the disease in terms of numbers of deaths In 1990 there were around 0 .2 million deaths from AIDS, ... 0.1 million deaths from leprosy, 0.3 million deaths from tropical diseases, 0.5 million deaths from diarrhoea, 0.4 million deaths from malaria and 1.8 million deaths from TB These figures can...
Ngày tải lên: 04/10/2012, 10:02
Write a report for a university lecturer describing the information in the two graphs below
... situation had changed radically by 1995 In 1995, 90% of women in Someland had completed secondary education and of those, half had graduated from an initial degree and 20 % had gone on to postgraduate ... postgraduate studies At the other end of the scale we can see that by 1995 all girls were completing lower secondary, although 10% ended their schooling at this point This is in stark contrast with ... 30% of girls completed primary school, 35% had no schooling at all and 35% only completed the third grade In conclusion, we can see that in the 50 years from 1945 to 1995 there have been huge...
Ngày tải lên: 04/10/2012, 10:02
Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc
... Congress Cataloging -in- Publication Data Arena, Mark V Why has the cost of Navy ships risen? : a macroscopic examination of the trends in U.S Naval ship costs over the past several decades / Mark V Arena, ... Defense, the Joint Staff, the Unified Combatant Commands, the Department of the Navy, the Marine Corps, the defense agencies, and the defense Intelligence Community For more information on RAND’s Acquisition ... top-down approach, to present results both in a timely fashion and in a way that encompasses as many relevant broad topics as possible Other organizations, such as the Naval Sea Systems Command’s (NAVSEA’s)...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Why Has the Cost of Fixed-Wing Aircraft Risen - A Macroscopic Examination of the Trends in U.S. Military Aircraft Costs over the Past Several Decades pptx
... (specialty metals and avionics systems, such as navigation equipment), materials and equipment used in aircraft manufacturing have increased in cost at roughly the same rate as other measures of in ation ... Joint Strike Fighter Lockheed Martin multi-mission maritime aircraft National Aeronautics and Space Administration North Atlantic Treaty Organization Naval Air Systems Command Northrop Grumman ... needed a database with detailed technical characteristics for each aircraft model HAPCA contains data on performance and weight—including cruising and maximum speed, empty and maximum weight, avionics...
Ngày tải lên: 17/02/2014, 23:20
Báo cáo khoa học: Chloroplast phosphoglycerate kinase from Euglena gracilis Endosymbiotic gene replacement going against the tide pdf
... according to Bradford [27 ] using bovine serum albumin as a standard Enzyme activity was measured photometrically at 20 °C in mL of 50 mM HEPES pH 7.6, 4.5 mM MgCl2, mM dithioerythritol, mM ATP, 20 0 ... Euglena, and probably also in the dinoflagellate Amphidinium, while others are not The LHCPs and RbcS are among the most abundant proteins in algae and plants Multigene families guarantee their synthesis ... stroma [48] In contrast, the segments of the PGK polyprotein are separated by a tetrapeptide (SVAM) A very similar topology was found in the dinoflagellate Amphidinium carterae, another organism...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Probing plasma clearance of the thrombin–antithrombin complex with a monoclonal antibody against the putative serpin–enzyme complex receptor-binding site docx
... of 20 nM 125 I-T–AT in the absence or presence of lM unlabeled T–AT, 0 .2 lM Fab M2 7, 0 .2 lM mAb M2 7, 0 .2 lM mAb M3 8, and lM cleaved AT Each bar represents the percentage of binding ± 2SD Binding ... T–AT complex in rats Thrombin, native AT, and elastase-cleaved AT were labeled with 125 I (Amersham Pharmacia AB, Uppsala, Sweden) using the chloramine T method, according to the supplier’s instructions ... papain (Sigma) After incubation with iodoacetamide (final concentration 70 mM) for 30 at room temperature, the digest was dialyzed at °C against M glycine, 150 mM NaCl, pH 8.0 The digest was then...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf
... from other prostanoids containing Thr as their standard amino acid at this position (Fig 1) This could mean that the Ser in IP and TP may discriminate PGI2 ⁄ TXA2 from the remaining prostaglandins ... domain of the human thromboxane A2 receptor allows discrimination between agonist and antagonist binding sites Mol Pharmacol 44, 934–939 20 Yamamoto Y, Kamiya K & Terao S (1993) Modeling of human ... USA) DNA polymerase and DpnI endonuclease were obtained from Stratagene (La Jolla, CA, USA) Rabbit anti-(human IP) serum was purchased from Cayman Chemical (Ann Arbor, MI, USA) Prostacyclin receptor...
Ngày tải lên: 23/03/2014, 07:20
A tasty transformation... from the outside in... & the inside out... docx
... Mix the meat and form 12 large meatballs Bake the meatballs 20 -30 minutes until golden and firm Remove the meat from oven and loosen with a thin spatula Place on top of spaghetti and pour tomato ... form 12 large meatballs Squish the balls to flatten them a bit like mini oval meatloaves Bake the meatballs 15 minutes until golden and firm Once the meatballs come out switch the broiler on Remove ... and puree With the machine running, add the olive oil in a steady drizzle Transfer the pea puree to a small bowl and stir in the parmesan Set aside To make the Salmon, warm the olive oil in a...
Ngày tải lên: 23/03/2014, 17:21
cottey a., edmunds t., forster a. femocratic control of the military in postcommunist europe. guarding the guards. 2002
... Parys affair demonstrated that the new postcommunist political society had much to learn about the management and control of the armed forces As Andrew A Michta has argued, the Parys affair made ... are as large as (in some cases even larger than) the regular armed forces, are quite heavily armed and have greater political impact and in uence than the regular military The roles and mechanisms ... in domestic politics, as, for example, in parts of Latin America in the 1970s) as the primary problem in establishing democratic control of armed forces In practice, and certainly in postcommunist...
Ngày tải lên: 04/06/2014, 00:37
– THE GRE VERBAL SECTION – 4. Once you understand a question, try to answer it in your own potx
... certain e Something which is catastrophic is disastrous That is the opposite of beneficial a Palatial means like a palace Chintzy means cheap and inelegant c Omniscient means all-knowing (omni means ... thunder in a mountain e by invoking an image of a circle The passage implies that laughter is always contained within a specific group because a a larger audience portends a larger laugh b the utility ... blind, intuitive calculation that, against all odds, the seeker will inevitably a overreach b commiserate c triumph d dominate e participate 18 Examining the means by which traditional societies...
Ngày tải lên: 18/06/2014, 17:20
Write a report for a university lecturer describing the information in the table below pptx
... In conclusion we can see there is a significant trend towards solitary and smaller group activities as people grow older and that teenagers and retired people spend a lot more time on entertainment ... grow older and that teenagers and retired people spend a lot more time on entertainment than those of working age ...
Ngày tải lên: 07/07/2014, 12:20
Báo cáo khoa học: "A giant hemolymphangioma of the pancreas in a 20-year-old girl: a report of one case and review of the literature" pptx
... demonstrating a large Abdominal Computed tomography demonstrating a large tumour with partial blood flow(arrow) in abdominal cavity This tumor may be asymptomatic for a long time Abdominal pain ... although the case reported by Banchini [4] had a slight increase in alkaline phosphatase and gamma-glutamyl transferase Serum carcinoembryonic antigen (CEA) and CA19-9 are within normal limits Imaging ... pain and awareness of abdominal mass are the most common symptoms Other infrequent symptoms such as vomiting and nausea are caused by occupied tumor This tumor is commonly a benign disease and has...
Ngày tải lên: 09/08/2014, 04:21
Báo cáo y học: "Evaluation of recombinant invasive, non-pathogenic Eschericia coli as a vaccine vector against the intracellular pathogen, Brucella" pptx
... system: enhancement of innate and adaptive mucosal immunity Curr Pharm Des 20 03, 9 (24 ):1965-19 72 Gherardi MM, Ramirez JC, Esteban M: Towards a new generation of vaccines: the cytokine IL- 12 as an ... Th1 type immune responses Infect Immun 20 00, 68(6): 329 0- 329 6 Rafiei A, Ardestani SK, Kariminia A, Keyhani A, Mohraz M, Amirkhani A: Dominant Th1 cytokine production in early onset of human brucellosis ... endoplasmic reticulum membranes [10,11] Bacteremia occurs during an acute phase that is hard to define or detect [ 12, 13] Live attenuated Brucella strains are widely used to vaccinate animals against...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " Hypertrophic osteoarthropathy as the cause of a super scan of the bone in a patient with prostate cancer: a case report" pps
... electrolytes and liver enzymes Creatinine was 77 μmol/l (normal: 64–108), alkaline phosphatase was elevated at 28 5 U/l (normal: 40– 120 ), calcium was 1.95 mmol/l (normal: 2. 15 2. 68) with an albumin of 23 .9 ... is associated with an intrathoracic malignancy, which can be carcinoma of the lung as well as pulmonary metastasis of other tumors and Hodgkin's disease involving the mediastinum HOA is also frequently ... facial tissues, which may simulate acromegaly [3] and finally, neurovascular changes of the hands and feet including chronic erythema, paresthesia and increased sweating Most commonly it is associated...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx
... "physiological" chemotactic factors in mammary secretions influencing the recruitment of PMN to goat's milk in late lactation and emphasized that increased infiltration of PMN to the mammary gland under ... proteins) in the milk after the PMI, which indicates that the mammary endothelial and epithelial permeability was not increased in this study The recruitment of PMN was further enhanced during day ... Acta Veterinaria Scandinavica 20 09, 51:4 Background A technical stop in an automated milking system (AMS) results in a prolonged milking interval (PMI) which for many cows may be fairly...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo y học: " Pre-notification of arriving trauma patient at trauma centre: A retrospective analysis of the information in 700 consecutive cases" doc
... declare that they have no competing interests Authors' contributions JJ gathered the data, participated in analyzing and interpretation the data, and participated in drafting and finalizing the manuscript ... Normally trauma admitting hospitals, including our, base their trauma team activation criteria on three categories including observed physiological signs, anatomical symptoms, and mechanism of injury ... study at a Danish level trauma centre Acta Anaesthesiol Scand 20 07, 51:11 72- 1177 Shatney CH, Sensaki K: Trauma team activation for "mechanism of injury" blunt trauma victims: time for a change?...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot
... of the UTR of exon of the gene was amplified by PCR using the BAC DNA as the template and oligos GGTCGACTTATATATTTATGAACACATTTA and CCCGGGATAACTTCGTATAATGTATGCTATACGAACGGTATCCTGAAATGGGGTCACCACACT ... copies of the modified BAC insert since the PstI CAT-hybridising fragment signals were more intense with DNA from mice from these two lines compared to animals from line 27 2 (Fig 3A and data not shown) ... purified away from the pB9 CAT recombinant plasmid [17] by a HincII/PstI digestion By sequential cloning, the SalI/SmaI goat αlac promoter fragment was linked to the CAT HincII/PstI cDNA using the...
Ngày tải lên: 14/08/2014, 13:22
260. A Night Out at the Movies in Washington pps
... inform the American people about the work of their lawmakers It also provides general information about political activities America’s cable television industry created CSPAN in nineteen seventy-nine ... eighty-four the Pointer Sisters won two Grammy Awards for their songs “Automatic” and “Jump (For My Love.)” Another of their songs remains popular today We leave you with that song, “I m So Excited,” ... to make a profit Cable television systems across the United States pay C-SPAN for its programs It does not receive any money from the United States government C-SPAN’s main purpose is to inform...
Ngày tải lên: 14/08/2014, 21:21
Tài liệu 10 Ways to Ignite the Passion In Your Life ppt
... fur, the warmth of a loved one's caress, the delicious aroma of the pie baking in the oven, the freshness of the air after a rain shower, the pleasing harmony of the songbirds heralding the dawn, ... take swift and decisive action to take advantage of opportunities The only way you can make your dreams come true is by taking action Otherwise, a dream is just a dream! Rather than sitting around ... thinking how nice it would be “if ”, find a way to make it happen Make a plan and go for it! Instead of wasting time worrying about the scary "what ifs," make the best plan you can and then take...
Ngày tải lên: 15/12/2013, 05:15