2 3 dioxygenase in primary endothelial cells
Báo cáo y học: "Comparison of capillary based microflurometric assay for CD4+ T cell count estimation with dual platform Flow cytometr" pps
Ngày tải lên :
10/08/2014, 05:20
... 100% 97% -95% 82% 100% EasyCD4** 30 6 25 2 196 108 79 70 52 24 Specificity Median FC* Total CD4 < 500 CD4 < 35 0 CD4 < 20 0 Sensitivity 29 0 22 7 1 92 104 28 0 24 9 21 0 118 28 4 23 9 20 5 1 12 *: FC = Flowcytometer ... showing CD3+ T cell gating and CD3+CD4+ T cells in EasyCD4 System Scatter plots showing CD3+ T cell gating and CD3+CD4+ T cells in EasyCD4 System Plot A: CD3+ cells (in red) are gated using the ... CD4+ T cells was 30 6 ± 20 7 cells/ mm3 by the flowcytometry and 29 0 ± 20 3 cells/ mm3 by the EasyCD4 System The CD4+ T cell counts estimated in the population under study ranged from 10 to 1110 cells/ mm3...
- 7
- 462
- 0
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx
Ngày tải lên :
18/06/2014, 15:20
... Induction of FoxP3 and acquisition of T regulatory activity by stimulated human CD4+CD25- T cells J Clin Invest 20 03, 1 12: 1 437 -14 43 http://www.translational-medicine.com/content/7/1/ 82 32 33 34 Klenerman ... not for citation purposes) Journal of Translational Medicine 20 09, 7: 82 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Malmberg KJ, Bryceson YT, Carlsten M, Andersson S, Bjorklund A, Bjorkstrom ... Immunol 20 02, 55 :22 1 -22 8 Karre K: Natural killer cell recognition of missing self Nat Immunol 20 08, 9:477-480 Lanier LL: NK cell recognition Annu Rev Immunol 20 05, 23 :22 5 -27 4 Uhrberg M: Shaping the...
- 13
- 404
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
Ngày tải lên :
18/02/2014, 14:20
... pipetting specific samples at different, randomly selected positions within the plate Sample Intraplate averages CV% Wells S1 S2 S1 S1 S3 S4 S5 S2 S4 S2 S6 56 6 12 73 727 53 686 48 659 18 010 35 34 22 ... samples, 10 lg of total protein in a 20 lL initial binding reaction was selected for use in all assays FEBS Journal 27 6 (20 09) 736 6– 737 4 ª 20 09 The Authors Journal compilation ª 20 09 FEBS K A Vuori et ... screening or determining binding affinities for transcription factor–DNA binding The results of measurements of HSF1 DNA-binding activity from HeLa cells and MEFs are in line with results reported in...
- 9
- 457
- 0
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf
Ngày tải lên :
18/06/2014, 15:20
... http://www.translational-medicine.com/content/6/1/56 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 ated virus/human papillomavirus type 16 E7 antigen gene transduction into dendritic cells Eur J Immunol 20 02, 32 : 30 -38 ... purposes) Journal of Translational Medicine 20 08, 6:56 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 alitis) in the allograft vascular wall A possible linkage with enhanced allograft arteriosclerosis ... 5'-GGTACCATGGAGTCCTCTGCCAAGA3'; downstream, 5'-CTCGAGGACCTTGTACTCATTACACATTG -3' AAV/IE1 virus stocks were generated using complementary plasmids ins96-0.8 or pSH3, using HEK2 93 cells as described previously [28 ,30 , 32 ] ...
- 8
- 451
- 0
Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc
Ngày tải lên :
20/06/2014, 01:20
... VP 22( 2) VP 22( 1) 72 36 36 58 29 29 1 13 37 37 39 189 32 32 32 32 32 29 55 42 42 Peptides within pool Amino Acid coordinates Virus Strain Peptide size/ overlap HSV -2 MS 18/11 HSV -2 MS 18/11 1 29 30 –58 ... 1 29 30 –58 1–5 12 1 26 3 25 3 5 12 1–414 1 21 3 20 3 414 HSV -2 MS 18/11 1 37 38 –74 75–1 13 1 27 0 26 0– 529 519–801 HSV -2 MS 18/11 1– 32 33 –64 65–96 97– 128 129 –160 161–189 1–55 1– 42 1– 42 1 23 3 22 3 457 447–681 ... Journal 20 06, 3: 54 http://www.virologyj.com/content /3/ 1/54 120 A: Subject B: Subject CD4 ELISPOTs 100 80 60 40 20 27 22 0-1 0 -2 0 -3 4-1 /2 4 -3/ 4 4-5/6 VP 22 gD 27 22 0-1 0 -2 0 -3 4-1 /2 4 -3/ 4 4-5/6 VP22...
- 15
- 329
- 0
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
Ngày tải lên :
09/08/2014, 10:21
... DBA/1 C57BL/6 94 96 61 30 Mean day of onset 24 .4 ± 1.9 18 .3 ± 2. 5 29 .4 ± 1 .3 81.7 ± 11.5 Maximum clinical score 4 .3 ± 0.9 5.8 ± 2. 3 3.1 ± 2. 2 2. 6 ± 1.0 Incidence There were 20 or more mice per group ... induce collagen-induced arthritis in H-2b background of C57BL/6 mice Immunology 20 06, 118 : 23 3 - 23 9 Williams RO: Collagen-induced arthritis as a model for rheumatoid arthritis Methods Mol Med 20 04, ... Study Group The New England Journal Of Medicine 20 00, 34 3:1594-16 02 21 Ory PA: Interpreting radiographic data in rheumatoid arthritis Ann Rheum Dis 20 03, 62: 597-604 Page of (page number not for citation...
- 8
- 372
- 0
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx
Ngày tải lên :
12/08/2014, 04:20
... GGATCCCGCCAGGAAGTGCTTTATTTGA 30 84 -31 03 3 122 -31 43 3098 -3 120 60 30 08 -30 33 4 637 -4665 1658 VP3-1 VP3 -2 Page of (page number not for citation purposes) Virology Journal 20 09, 6:1 42 Development and optimization ... 10 .20 ± 0.18 8. 72 ± 0 . 23 8.16 ± 0.14 8.61 ± 0 . 23 7.10 ± 0 .21 7.45 ± 0.16 4.50 ± 0 . 23 6.78 ± 0.11 8.08 ± 0 . 23 8.97 ± 0.19 4.97 ± 0. 02 7.56 ± 0.16 8.84 ± 0.05 7.97 ± 0. 12 7.85 ± 0.19 6 .21 ± 0 .21 ... calculated and are indicated (1 :2. 8 × 108, Ct = 12. 7; 2: 2. 8 × 107, Ct = 16 .2; 3: 2. 8 × 106, Ct = 19.4; 4: 2. 8 × 105, Ct = 22 .9; 5: 2. 8 × 104, Ct = 25 .9) sample could be calculated using the cycle...
- 7
- 338
- 0
Báo cáo y học: "Isoniazid prophylaxis differently modulates T-cell responses to RD1-epitopes in contacts recently exposed to Mycobacterium tuberculosis: a pilot study" pdf
Ngày tải lên :
12/08/2014, 15:20
... (46) 11 (46) (89) (11) (11) 30 (68) 14 ( 32 ) 18 (41) (16) (33 ) (50) (20 ) (80) (29 ) (37 .) (33 ) (11) 1(11) (78) (20 ) 13 (30 ) 22 (50) Median age (years) Female gender N (%) Index cases, N Country of ... 6.5 23 .5 ± 3. 8 20 .2 ± 6.1 7 .3 ± 2. 2 5.7 ± Ns Ns Ns Ns Ns Ns Ns Ns Ns Ns INH therapy PHA PPD QTF-G RD1 proteins RD1 peptides 24 (100) 24 (100) 24 (100) 19 (79) 18 (75) 15 ( 63) 14.7 ± 2. 7 17.6 ± 2. 8 ... 3. 8 6.1 ± 17.1 ± 4.5 33 ± 3. 4 12. 3 ± 4.4 8.9 ± 3 .2 2 .2 ± 0.5 17.5 ± 4.6 29 .3 ± 4.5 16 .3 ± 6.7 13. 5 ± 6.1 4.6 ± Ns Ns Ns Ns Ns Ns Ns Ns Ns Ns INH therapy PHA PPD QTF-G RD1 proteins RD1 peptides (100)...
- 10
- 294
- 0
Design of artificial microenvironment for cord blood CD34+ cells expansion ex vivo
Ngày tải lên :
04/10/2015, 15:44
... H H2 C CH2 N H H2 C N H CH2 CH2 OH C H2 4b) + FN 5b) Wash N H FN FN N H == H2 C H2 C H2 C CH2 CH2 CH2 H2 C CH2 OH C H2 H2 C OH C H2 N H H2 C CH2 CH2 N H CH2 OH C H2 H2 C H2 C CH2 CH2 H2 C H2 C ... buffer O O O NH2 HC CH2 CH2 CH CH2 N H H2 C CH2 CH2 CH CH2 1) + Glutaraldehyde (GA) O 2a) Wash N H 3a) + FN N H 4a) Block N H 5a) Wash N H H2 C CH2 CH2 CH2 H2 C CH2 H2 C CH2 CH2 H2 C CH2 N H N H N ... 24 3 .2. 1 MSC culture 24 3 .2. 2 Ex vivo expansion of CB CD34+ cells in co-culture systems .24 3 .2. 3 CFC 26 3 .2. 4 Animal engraftment 26 3. 3 MSC and CB CD34+...
- 93
- 273
- 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt
Ngày tải lên :
19/02/2014, 13:20
... FEBS 20 04 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Design of peptides for T-cell adhesion inhibition (Eur J Biochem 27 1) 28 85 Blockade of CD2–LFA )3 interactions protects human skin allografts ... Macromolecules: a 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Practical Approach (Roberts, G.C.K ed.), pp 35 9 39 0 Oxford University Press, New York Srinivasan, N., Sowdhamini, R., Ramakrishnan, ... following colors: Lys 32 , Glu25 (purple); Asp 33, Lys29, Glu37 (blue); Lys30 (magenta) Residues, Asp 33 and Lys29 were shown to be important in binding to peptides from CD2 in docking studies (B) Crystal...
- 14
- 657
- 0
Báo cáo y học: " PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein is essential for the interleukin 2 independent growth induction of a T-cell line" ppsx
Ngày tải lên :
13/08/2014, 09:21
... citation purposes) Retrovirology 20 05, 2: 46 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Sugamura K, Hinuma Y: Human retroviruses:HTLV-I and HTLV-II In The Retroviridae Volume Edited ... T-cell lines [38 ] Tax2, however, did not induce IL -2- independent growth of CTLL -2 cells In addition to Tax2B, Tax2B+C also failed to induce IL -2- independent growth of CTLL -2 cells Tax2B+C, but ... C- x Ta C -2 Vector Tax1- 12 Tax1 -24 Tax C-7 Tax C -21 x1 Ta 3. 5 3. 0 5.0 1.5 2. 0 1.0 1.0 Tax353A 2. 0 3. 0 Vector̙ Tax1 Tax351A 2. 5 4.0 3A 1A 35 35 ax ax T T 0.5 0 ' ' ' ' Days after IL -2 withdrawal...
- 7
- 177
- 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
Ngày tải lên :
21/02/2014, 00:20
... an aspartate 52- phosphoenzyme intermediate J Biol Chem 27 6, 33 526 33 5 32 23 Clauser, K.R., Baker, P.R & Burlingame, A.L (1999) Role of accurate mass measurement [+/- 10 ppm] in protein identification ... protein utilizing the principle of protein-dye binding Anal Biochem 72, 24 8 25 4 20 Laemmli, U.K (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 22 7, ... transformation in Ó FEBS 20 03 eEF1A binding to aptameric cytotoxic GT oligomers (Eur J Biochem 27 0) 32 6 1 mouse 3T3B cells [ 42] It was suggested that this modification should account for differences in growth...
- 12
- 552
- 0
Báo cáo khoa học: Introduction of extended LEC14-type branching into core-fucosylated biantennary N-glycan Glycoengineering for enhanced cell binding and serum clearance of the neoglycoprotein pot
Ngày tải lên :
30/03/2014, 16:20
... glycan-dependent FEBS Journal 27 2 (20 05) 1986–1998 ª 20 05 FEBS ´ S Andre et al 22 23 24 25 26 27 28 29 30 31 32 33 34 functions in mammalian physiology and insights into disease pathogenesis Glycobiology ... binding of galectin-1 and functional divergence from galectin -3 J Biol Chem 27 6, 35 917 35 9 23 Brewer CF (20 02) Binding and cross-linking properties of galectins Biochim Biophys Acta 15 72, 25 5 26 2 ... 1 02 74.4 % /29 .4 101 1 02 104 128 100 128 128 104 E 100 101 98 .2 %/177.8 83. 3 %/ 420 .6 number of events 1 03 1 03 C B 70 .3 % /25 2 .2 101 1 02 1 02 A 100 101 B 0 number of events 100 100 128 128 Fig Semilogarithmic...
- 13
- 323
- 0
Báo cáo hóa học: " Strategy Escalation: An emerging paradigm for safe clinical development of T cell gene therapies Richard Paul Junghan" pdf
Ngày tải lên :
18/06/2014, 16:20
... Phase I trial for the treatment of purine analogrefractory chronic lymphocytic leukemia using autologous T cells Page of 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 genetically targeted to the ... Cancer Immunol Immunother 1991, 32 : 36 4- 72 Finn RS, Slamon DJ: Monoclonal antibody therapy for breast cancer: Herceptin Cancer Chemother Biol Response Modif 20 03, 21 :22 3- 33 Ma QZ, DeMarte L, Wang YW, ... targeting CD19 in lymphoma [24 ,25 ] and the other targeting Her2/neu in breast cancer [26 ,27 ] Both were previously untested targets for designer T cells The patients in each case were treated with 2nd...
- 8
- 474
- 0
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot
Ngày tải lên :
18/06/2014, 16:20
... produce intracellular cytokines within hours after stimulation in vitro [22 ], but the CD27+ anti-CD3-expanded CD8 cells (in contrast with the CD27- cells in the same preparation) produced little intracellular ... T cells in primary cultures at 7 -21 days after stimulation with anti-CD3/CD28 beads and OKT3 Day after Stimulation Cells stimulated with: 14 21 Anti-CD3/CD28 beads 34 .0 ± 6.8 (11)* 47.6 ± 6 .3 ... by Hawkins, et al [21 ] In brief, to label cells, 2- 5 × 107 mixed mononuclear cells or cultured T cells maintained in RPMI 1640 containing 10% fetal calf serum plus 100 unit/ml penicillin, 100...
- 15
- 503
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... T cells in peripheral blood J Clin Invest 20 03, 111 :21 7 -22 3 Eisenbarth GS, Kotzin BL: Enumerating autoreactive T cells in peripheral blood: a big step in diabetes prediction The Journal of Clinical ... changes in pathogenic T -cells Diabetes 20 05, 54:1415-1 422 43 D’Cruz LM, Klein L: Development and function of agonist-induced CD25 +Foxp3+ regulatory T cells in the absence of interleukin signaling ... decreasing FoxP3 and TGFbeta1 coexpressing CD4+CD25+ regulatory T cells during autoimmune diabetes J Exp Med 20 05, 20 1: 133 3- 134 6 38 Brusko TM, Wasserfall CH, Clare-Salzler MJ, Schatz DA, Atkinson...
- 12
- 573
- 0
báo cáo hóa học: " Persistently elevated T cell interferon-γ responses after treatment for latent tuberculosis infection among health care workers in India: a preliminary report" pot
Ngày tải lên :
20/06/2014, 00:20
... Occupational Medicine and Toxicology 20 06, 1:7 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 LW, Colford JMJ: Mycobacterium tuberculosis infection in health care workers in rural India: comparison ... C virus J Immunol 20 02, 169(4) :22 10 -22 14 Lalvani A: Counting antigen-specific T cells: a new approach for monitoring response to tuberculosis treatment? Clin Infect Dis 20 04, 38 (5):757-759 Higuchi ... tuberculin skin test Clin Infect Dis 19 93, 17(6):968-975 Menzies D: What does tuberculin reactivity after bacille Calmette-Guerin vaccination tell us? Clin Infect Dis 20 00, 31 Suppl 3: S71-4 Pai...
- 7
- 492
- 0
Báo cáo sinh học: " Systematic identification of regulatory proteins critical for T -cell activation" doc
Ngày tải lên :
06/08/2014, 18:20
... 1 03 1 02 1 02 R2 101 101 1 02 1 03 CD3 R2 101 1.0% 100 100 104 100 100 23 .2% 101 1 02 1 03 104 (c) 104 1 03 R2 101 1 02 1 03 R2 101 24 .0% 101 104 100 100 13. 0% 101 1 02 1 03 CD3 20 0 − Dox 160 + Dox 120 ... GYF domain Sense NM_ 022 574.1 +1, + 121 nt No SCAMP2 Secretory carrier membrane protein Sense AF005 038 .2 -5, + 833 nt No KIAA 122 8 C2 domain (Ca2+- or IP-binding) Sense AB 033 054 .2 nt 1 439 -21 63 No ... GFP− 38 1 31 3 EDG1 15 10 10 100 CD69 CD69 CRIB 524 24 9 Protein kinase PAK2 1 13 Hit 1 22 4 Pro 20 Dox ratio = 12. 5 Original clone + Anti-TCR 20 30 0 20 0 SH2 101 1 02 1 03 CD69 104 Events 104 100 101 37 ...
- 16
- 316
- 0
Báo cáo y học: " Chitosan Interferon-c Nanogene Therapy for Lung Disease: Modulation of T-Cell and Dendritic Cell Immune Responses" pps
Ngày tải lên :
08/08/2014, 21:20
... implying that IFN-c may be a key cytokine in asthma . 23 IFN-c provides the stimulatory signal for interleukin (IL)- 12, 23 ,24 which is a strong inducer of the Th1 response IL- 12 inhibits Th2 cells ... mobilization by interferon-gamma J Biol Chem 20 02; 277:1 038 7– 93 32 Ford JG, Rennick D, Donaldson DD, et al IL- 13 and IFN-gamma: interactions in lung inflammation J Immunol 20 01;167:1769– 77 33 Krasnowska ... high-affinity receptor for immunoglobulin G; H1-T 23 histocompatibility t 23 region; H2-Q1 histocompatibility 2- Q region; Ifnar2 interferon-a receptor 2; Isg15 interferon-induced protein, 15 kDa;...
- 11
- 486
- 0