2 2 loss of interneurons and its association with hyperexcitability

Patterns of hippocampal neuronal loss and axon reorganisation of the dentate gyrus in the mouse pilocarpine model of temporal lobe epilepsy

... model………………………………………………… 21 1.4.1 .2 SE model………………………………………………………… .22 1.4 .2 Hypotheses of epileptogenesis from previous studies………………… 22 1.4 .2. 1 The “dormant basket cell” hypothesis…………………………… .22 1.4 .2. 2 Loss of interneurons ... hypothesis (Sloviter, 20 03) 2 Loss of interneurons and its association with hyperexcitability Another generally accepted hypothesis is that loss of hilar interneurons induces hyperactivity of granule cells ... of interneurons and its association with hyperexcitability 24 1.5 Hypotheses and aims of the present study……………………………………… .26 CHAPTER 2: MATERIALS AND METHODS………………………………… 29 2. 1 Pilocarpine...

162
596
0

Báo cáo hóa học: " Lateral homogeneity of the electronic properties in pristine and ion-irradiated graphene probed by scanning capacitance spectroscopy" pot

Danh mục: Hóa học - Dầu khí

... [22 ] 16  2 v F l ci  E F   Z 2q N ci  q2 1   v F  0    EF   (2) where ε = 2. 4 is the average between ε ox and the vacuum relative dielectric constant, Z is the net charge of ... consistent with the common adopted picture of the 2DEG split in a landscape of adjacent “electron-hole puddles” [21 ] Close to the Dirac point, the effect of a gate bias is limited to a redistribution of ... Industriale, 95 121 , Catania, Italy 2Scuola Superiore di Catania, Via San Nullo, 5/I, 95 123 , Catania, Italy 3Department of Physics and Astronomy, University of Catania, Via S Sofia, 95 123 , Catania,...

8
292
0

Báo cáo hóa học: " Lateral homogeneity of the electronic properties in pristine and ion-irradiated graphene probed by scanning capacitance spectroscopy" potx

Danh mục: Hóa học - Dầu khí

... [22 ] 16  2 v F l ci  E F   Z 2q N ci  q2 1   v F  0    EF   (2) where ε = 2. 4 is the average between ε ox and the vacuum relative dielectric constant, Z is the net charge of ... consistent with the common adopted picture of the 2DEG split in a landscape of adjacent “electron-hole puddles” [21 ] Close to the Dirac point, the effect of a gate bias is limited to a redistribution of ... Industriale, 95 121 , Catania, Italy 2Scuola Superiore di Catania, Via San Nullo, 5/I, 95 123 , Catania, Italy 3Department of Physics and Astronomy, University of Catania, Via S Sofia, 95 123 , Catania,...

8
400
0

Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"

Danh mục: Y học thưởng thức

... 38.3 9.0 34.0, 42. 7 0.0013 5-Loxin 100 mg/day 19 48 .2 6.1 26 .2 16.5 18 .2, 34.1

12
606
0

Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"

Danh mục: Y học thưởng thức

... Research 20 05; 22 (2) :22 1 -23 1 80 Barabasz A, Barabasz M, Jensen S, et al Cortical event-related potentials show the structure of hypnotic suggestions is crucial The International Journal of Clinical and ... declared that no conflict of interest exists 19 20 21 22 23 24 References Sabatini RME Mapping the brain Brain and Mind Magazine 1997; Pritchard WS Psychophysiology of P300 Psychological Bulletin ... 38:169-186 25 26 27 28 29 Näätänen R The role of attention in auditory information processing as revealed by event-related potentials and other brain measures of cognitive function Behavioral and Brain...

8
563
0

Teachers’ and teacher evaluators’ perceptions of the current teacher evaluations and teaching assessment criteria

Danh mục: Khoa học xã hội

... processes (2 points) Organization and control of positive and active learning of students, appropriate for the content of the lesson and all students, good motivation of students’ learning (2 points) ... evidence of having a theoretical background and knowledge of the principles and methods of teaching and commitment to education as profession Indicators: - Keeps abreast of current and effective ... activities (2 points) Facilities (4 points) Good combination of teaching facilities and equipment well and adequately with the content of the lesson (2 points) Reasonable board presentation, clear handwriting...

7
425
0

Tài liệu Đàn tính The Marvelous and Sarced Musical Instrument of the Tay People- La Công ý pptx

Danh mục: Âm nhạc

... the steam and later figure Mrs Mỗ Thị Kịt and her apprentices perform at the vme (in 20 04?) La Công Ý, Vme archive 28 2 | Asian Ethnology 67 /2 • 20 08 figure The first festival of Then and đàn tính ... member, accidents, or the death or loss of livestock On the first and the fifteenth day of the month, the day “without souls,” the day of “three funerals,” and while performing a ritual, Then ... placed in a storeroom of the Vme with other secular artifacts In 20 03, when it was used in the exhibition Vietnam: Journeys of Body, Mind, and Spirit, those of us who were familiar with Tày culture...

16
617
0

Tài liệu THE ELDERLY AND MOBILITY: A REVIEW OF THE LITERATURE pdf

Danh mục: Sức khỏe người cao tuổi

... bias 17 2. 1.3.1 Explaining the low mileage bias 19 2. 1.4 Conclusions 20 2. 2 VULNERABILITY 20 2. 2.1 Findings from the OECD Working Group 20 2. 2 .2 Findings ... group) 60.1 76 .2 0.0 -2. 5 19.1 2. 4 No of A&E transfers over years 5737.5 143 12. 0 123 13.5 320 9.5 128 2.5 21 5.0 A&E transfers per 100 million driver miles 45.64 10.33 6.44 8.09 16.34 25 .29 Excess A&E ... effectiveness of assessment of fitness to MONASH UNIVERSITY ACCIDENT RESEARCH CENTRE drive; impact of loss of licence on safety; impact of loss of licence on mobility; and impact of the ‘greying of society’...

134
608
0

Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt

Danh mục: Tự động hóa

...

24
865
0

Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Danh mục: Ngân hàng - Tín dụng

... Hawaii 17 .2% 20 .6% 5,354 22 .5% Illinois 13.7% 17.4% 48, 425 21 .8% Maryland 12. 8% 16.4% 22 , 524 20 .9% Texas 16.0% 20 .6% 61,4 82 20.3% Nevada 19.1% 24 .8% 8 ,27 8 20 .2% District of Columbia 12. 7% 16.7% ... 555 ,22 4 47, 724 21 ,398 39,399 24 ,694 43 ,23 4 13,560 16,864 39,9 82 15,696 21 ,354 16 ,22 0 21 ,499 17,819 15,771 5,156 29 ,656 19,848 21 ,508 11 ,23 3 8,375 9,558 9,704 84,9 72 189 ,28 1 107,966 20 , 624 28 ,26 2 ... 12, 184 8,9 02 97,510 94,068 83,9 52 151, 621 42, 779 12, 813 25 , 928 28 ,418 37 ,29 5 27 ,145 20 ,25 0 13,809 8 ,22 3 19,191 13 ,20 3 396, 928 106,361 56, 420 34, 728 33,779 19,569 13,650 19,603 30,405 10,467 22 ,404...

37
436
0

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Danh mục: Báo cáo khoa học

... within residues 27 0–364 that binds actin has not been mapped and may be distinct from the sequence VH2-N [23 ] We use the nomenclature VH2 rather than WH2 because the sequence of VH2-C and VH2-N ... (MATa lys2 his4 leu2 ura3 vrp1D::KanMx bar1) [23 ], IDY166 (MATa his3 leu2 ura3 trp1 las17D::URA3) [20 ], and PJ69-4A (MATa his3 leu2 ura3 trp1 gal4D gal80D met2::GAL7-lacZ GAL2-ADE2 LYS2::GAL1–HIS3) ... 87–98 15 Sun Y, Martin AC & Drubin DG (20 06) Endocytic internalization in budding yeast requires coordinated 17 18 19 20 21 22 23 24 25 26 27 actin nucleation and myosin motor activity Dev Cell 11,...

23
679
0

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

Danh mục: Báo cáo khoa học

... expression of hyaluronan receptors Dev Dyn 23 6, 22 58 22 67 33 Lincoln J, Alﬁeri CM & Yutzey KE (20 04) Development of heart valve leaﬂets and supporting apparatus in chicken and mouse embryos Dev Dyn 23 0, ... Expression pattern of tsA58T Ag in T26 ⁄ Tie2–Cre double-transgenic mice (A) tsA58T Ag (red) was expressed in CD31-positive ECs (green) of an E9.5 T26 ⁄ Tie2–Cre double-transgenic embryo and its yolk sac ... Lyve-1 The early mortality of the T26 ⁄ Tie2–Cre doubletransgenic mice is a disadvantage for the generation of T26 ⁄ Tie2–Cre double-transgenic mice with a mutation in a gene -of- interest In addition,...

11
873
0

Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx

Danh mục: Báo cáo khoa học

... MP and HPO were obtained with an excitation wavelength of 360 nm and a ﬁlter with a cutoff of 395 nm for emission FEBS Journal 27 4 (20 07) 22 40 22 52 ª 20 07 The Authors Journal compilation ª 20 07 ... constants of the reduced pterin HP are the same as those of the oxidized pterin FEBS Journal 27 4 (20 07) 22 40 22 52 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 22 45 Mechanism and kinetics of dihydroneopterin ... Crystal structure and reaction FEBS Journal 27 4 (20 07) 22 40 22 52 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 22 51 Mechanism and kinetics of dihydroneopterin aldolase 10 11 12 13 14 15 16 17...

13
479
0

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Danh mục: Báo cáo khoa học

... peptide of PhoD and the TatAd ⁄ Cd proteins of Bacillus subtilis form an autonomous FEBS Journal 27 2 (20 05) 22 61 22 75 ª 20 05 FEBS C M L Barrett and C Robinson 17 18 19 20 21 22 23 24 25 26 27 Tat ... E103Q E103A R104A R105A F118A G 121 A Y154S F169A P172A T208A P209A D211N D211A L 225 A Sequence 5’ to 3’ Substitution G2A F W7P F I12P F V16G F F20A F G21A F K24A F L25A F G33A F F39A F K37Q F gaggaattcaccatggctggtatcagtatttgg ... Name of primer TatA mutants G2A 3Pro3Gly I12P 3Pro6Gly F20A G21A K24A L25A G33A F39A 3K > Q TatB mutants E8Q E8A 3Gly V12P G21A P22G P22L L25A P26A L63A 2R > N 3K > Q TatC mutants P48A I81M P85A...

15
532
0

Báo cáo " On equations of motion, boundary conditions and conserved energy-momentum of the rigid string " doc

Danh mục: Báo cáo khoa học

... Nambu-Gato string.In the case of Lagrangian (25 ) equations of motion have the form (γ − α2xµ 2xµ )2xµ + 2 2( 2xµ ) − g ij xν xµ,j 2( 2xν ) − 4αg ij g kz (2xν ),j xν ∇i xµ,z = (27 ) ,i ,k where ∇a x ∇i ... case of Lagrangian (25 ) have following form √ √ Bµ (τ, σ) = −g(γ − α2xµ 2xµ )g 1ixµ,i + 2 −gg jk xλ xλ,jk 2xµ + eqno(3.8) ,i √ √ √ +4α −g2xσ xσ g 1j Gik xµ,k + 2 ∂0 −gg 01 2xµ + 2 ∂j −gg 1j 2xµ ... ,ij √ ( 32) Cµ (τ, σ) = 2 −gg 112xµ The energy-momentum density pµ has the following form √ √ Pµ = −gg 0j (γ − α2xσ 2xσ )xµ,j + 2 ∂0 −gg 002xµ + √ +2 −gg 0ig jk 22 xσ xσ xµ,k + xλ xλ,i 2xµ ij...

8
428
0

Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme speciﬁcity of the wild-type enzyme docx

Danh mục: Báo cáo khoa học

... ND, not determined NAD+ NADP+ pH Wild-type F238S P262S F238S P262S D263K Wild-type F238S P262S F238S P262S D263K Wild-type F238S P262S F238S P262S D263K kcat (s)1) Km (mM) 6.0 6.0 6.0 6.0 6.0 ... ND 0 .26 0.01 1.1 0.7 1 .23 0 .22 0.6 32 0 .27 0.380 0.0 02 0.336 0.015 2. 04 0.08 1.04 0.30 2. 24 0.77 0.336 0.05 0 .22 4 ND ND ND ND 2. 19 0.113 0.371 0.3 82 1.05 2. 70 0.1 32 0.339 0 .22 9 2. 85 ... 0. 02 0.51 0. 02 0.10 0. 02 1.00 0.05 0.314 0.034 ND 0.18 0. 02 0.114 0.0 12 1 .25 0.46 1.04 0.13 2. 22 0 .21 0.17 0. 02 0. 127 0 12 1.83 0.04 0.90 11 6 .28 0.34 0.376 0.03 1. 92 20.4 17.6 23 .0...

9
526
0

Báo cáo khoa học: Substrate preference and phosphatidylinositol monophosphate inhibition of the catalytic domain of the Per-Arnt-Sim domain kinase PASKIN ppt

Danh mục: Báo cáo khoa học

... et al (20 03) Targeted disrup- FEBS Journal 27 8 (20 11) 1757–1768 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 1767 Targets and stimulation of PASKIN 15 16 17 18 19 20 21 22 23 24 25 P Schlaﬂi ... al ¨ serines of S6, starting with S236 and S235 (i.e the same sites as shown in the present study for PASKIN) followed by S240, S244 and S247 [25 ] A second family of S6 kinases are p90 ribosomal ... fusion proteins with wild-type S6, with the nonphosphorylatable double-mutant S235 ⁄ 23 6A, with eEF1A1, or with its nonphosphorylatable T432A mutant, in the presence of [c-33P]ATP and PtdIns phosphates...

12
353
0

Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx

Danh mục: Sức khỏe giới tính

... Nutrition Journal 20 04, 3:19 20 5 20 6 20 7 20 8 20 9 21 0 21 1 21 2 21 3 21 4 21 5 21 6 21 7 21 8 21 9 22 0 22 1 22 2 22 3 22 4 cancer in women in the Nurses' Health Study Ann Intern Med 1998, 129 :517- 524 Kato I, Dnistrian ... Health Study Serum 25 (OH)D & 1 ,25 (OH)D2 23 2 414 [22 2] Nurses' Health Study Dietary and supplement intake [22 3] Finnish clinical cohort Serum 25 (OH)D & 1 ,25 (OH)D2 146 29 2 [22 4] NHANES I Follow-up ... [22 6] Randomized controlled trial for colon adenoma recurrence Norway, Finland, Sweden cohort of men Serum 25 (OH)D & 1 ,25 (OH)D2, and supplementary calcium Serum 25 (OH)D 803 subjects total [22 7]...

21
740
0

CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot

Danh mục: Mỹ thuật

... (p 27 5) 1 526 Birth of daughter Caterina Lucrezia (p 185) 1 527 Visits in Correggio (p 27 4) Circa 1 528 Birth of daughter Anna Geria (p 185) 1 528 Visit in Correggio in summer (p 27 4) 1 529 Death of ... and Noli me tangere (p 22 6) 1 521 Birth of son Pomponio, September (p 185).[xiv] 1 522 Visit to Reggio and commission for the Nativity (La Notte) October (pp 195, 29 4) Commission for frescoes of ... child and his mother, and go into the land of Israel; for they are dead which sought[50] the young child's life And he arose, and took the young child and his mother, and came into the land of Israel." [21 ]...

87
566
0

Báo cáo khoa học: Identiﬁcation of the amniotic ﬂuid insulin-like growth factor binding protein-1 phosphorylation sites and propensity to proteolysis of the isoforms docx

Danh mục: Báo cáo khoa học

... 25 493 Da 21 + 20 + 22 + 19+ 18+ 23 + 17+ 16+ 25 + 24 + 22 + 13+ 14+ C 25 410 Da 21 + 20 + 19+ 18+ 23 + 25 + 15+ 17+ 16+ 15+ 13+ 14+ 24 + B 21 + 20 + 19+ 22 + 16+ 18+ 23 + 25 + 17+ 15+ 24 + 14+ 13+ A 1000 120 0 25 331 ... 4 12. 4 4 12. 4 4 92. 4 5 72. 3 6035 Phosphorylation of amniotic ﬂuid human IGFBP-1 L Dolcini et al 23 + 22 + 21 + 20 + 24 + 19+ 25 + 27 + 18+ 17+ 16+ 26 + E 25 5 72 Da 21 + 20 + 23 + 22 + 19+ 18+ 25 + 24 + 27 + 17+ 26 + ... 25 25 +1 .2 +1.3 +1.4 +2. 1 )0.7 +0.1 I II III IV V VI FEBS Journal 27 6 (20 09) 6033–6046 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 25 1 .2 331.1 411.0 410.3 493.1 5 72. 2 25 2.4 3 32. 4 4 12. 4...

14
469
0