2—kinds of concrete and degree of removal
(1) how learners approach learning, both in and out of classrooms, and (2) the kinds of strategies and cognitive processing they use in second language acquisition
... range and the frequency of strategies use between learners of different levels, favoring professional linguists and learners with higher level of proficiency Research in Asia, such as in Thailand ... powerful impact of learning strategies on the learning and teaching of foreign and second language Good choice and use of learning strategies would help learners become more independent and autonomous ... acquisition and the ultimate level of achievement Learners’ success and their level of L2 proficiency would, in turn, have effect on learners’ choice of learning strategies Learner’s choice of learning...
- 83
- 622
- 0
Exergoeconomic performance optimization of an endoreversible intercooled regenerated Brayton cogeneration plant Part 2: Heat conductance allocation and pressure ratio optimization
... increase of U T , (uh )Π and π Π max, increase, and (ul )Π max, and (uk )Π max, max, decreases, (ui )Π max, decrease first and then increase Figures7 and show the characteristics of Π max, and (ηex ... Characteristics of Π max, and (ηex )Π versus τ Figure Characteristics of (u j )Πmax, , max, max, max, max, j = h, l , k , i and j = h, l , k , i and versus b Figure 12 Characteristics of (u j )Πmax, , πΠ and ... Science and Engineering and the Director of the Department of Power Engineering Now, he is the Superintendent of the Postgraduate School, Naval University of Engineering, P R China Professor...
- 8
- 394
- 0
2 - Interaction of Electrons and Photons
... eigenstates j j i of the electron and the eigenstates jnm i of optical field of each mode m Here J is a label for the combination of electron states and states of field modes ( j and {nm}), and jCJ i ... application of a to jni results in an eigenstate of N with an eigenvalue n 1, and application of ay to jni results in an eigenstate of N with an eigenvalue n ỵ From this and the normalization of the ... made of Eqs (2.34), (2.36b), and (2.39) Application of hCJ j to both sides of Eq (2.41), with the use of the orthonormal relation Copyright â 2004 Marcel Dekker, Inc Interaction of Electrons and...
- 20
- 297
- 0
Tài liệu A.2. Four Kinds of Installation doc
... glitch-proof copy of 10.5 See "The Clean Install" on Section A.6 MacOSX10.5 In times of dire troubleshooting, when nothing in Appendix B has helped, you can actually give yourself a fresh copy of 10.5,...
- 2
- 318
- 0
Tài liệu Chapter 2: Indicators of Financial Structure, Development, and Soundness ppt
... (%) Size of derivative markets • • • • Types and number of schemes (unique and mixed funds) Total assets and growth rates (nominal and as percentage of GDP) Total number of investors and average ... ease of entry, price of services, and so forth In addition, the degree of diversity of the financial system could be an indicator of competition or the lack thereof because the emergence of vibrant ... • • • • Number of listed securities (bonds and equities) Share of households, corporations, banks, and NBFIs in the holdings of securities Number and value of new issues (bonds and equities) Market...
- 19
- 543
- 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... using the purified recombinant protein, the conversion of reagents and products of the exopeptidasecatalyzed hydrolysis of Met1 and cyclization of Gln1 to pyroglutamyl were monitored at different ... first h of the reaction Guanidinium chloride concentration pH 6.2 7.2 8.0 Fig Comparison of the hydrolysis reaction as a function of denaturing agent and pH (A), (B) and (C): (d), (s) and (.) ... to 2.5, 8.0 and 11.5 and the samples were incubated at 37 °C, 50 °C and 70 °C Aliquots were taken at different time-points from each sample and analyzed by MALDI-TOF MS The addition of the protease...
- 9
- 704
- 0
Tài liệu Báo cáo khoa học: "Word Vectors and Two Kinds of Similarity" pptx
... of a word t i in a piece sj of document wij = tfij ì log m +1 dfi (3) In this formula, tfij denotes the number of times the word ti occurs in a piece of text sj , and dfi denotes the number of ... assessed as the number of times words ti and tj occur in the same piece of text, and thus M is an n ì n symmetric matrix As in the case of the LSA-based method, we use two units of text piece (i.e., ... the dimension of the vectors increased as in the case of synonym judgment, the scores of both LSA-based and cooccurrence-based vectors had a peak around 200 dimensions, as Landauer and Dumais (1997)...
- 8
- 473
- 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc
... 1,2,4-trihydroxybenzene and pyrogallol) in aqueous solution were always freshly prepared and used immediately Effect of various compounds on the enzyme activity The effect of metal salts, and chelating and sulfhydryl ... ± 0.10 lmol of 4-amino-3-hydroxybenzoic acid and 0.90 ± 0.08 lmol of O2 were consumed and 1.1 ± 0.02 lmol of 2,5-pyridinedicarboxylic acid was formed, which indicated a molar ratio of 4-amino-3-hydroxybenzoic ... with a linear gradient (0–0.4 M) of NaCl in 900 mL of buffer A Fractions of mL were collected at a flow rate 40 mLÆh)1 The protein concentration and enzyme activity of the fractions were assayed...
- 7
- 490
- 0
Additives and contaminants 2 - Principle of food chemistry
... leaves, seeds, and fruits of more than 63 species of plants growing all over the world It occurs as a constituent of coffee, tea, cocoa, and chocolate, and is an additive in soft drinks and other ... lead and tin may be taken up by foods from the tin of cans and from the solder used in their manufacture The amounts of lead and tin taken up depend on the type of tin plate and solder used and ... distribution of 137Cs levels in milk In Sweden, the lowest levels of the isotope 90Sr were found for the island of Gotland, which has low precipitation and a soil rich in calcium Johnson and Nayfield...
- 25
- 352
- 0
Báo cáo hóa học: " Role of protease-activated receptor-2 on cell death and DNA fragmentation in Helicobacter pylori-infected gastric epithelial cells" ppt
... role of PAR-2 on the activation of MAPK, the activation of three major MAPK involved in cell proliferation and apoptosis were assessed by Western blotting of phospho-specific and total forms of ... presence of H pylori at bacterium/cell ratio of 300:1 for hours Determination of cell viability and DNA fragmentation AGS cells were cultured in the presence of H pylori at a bacterium/cell ratio of ... the activation and expression of PAR-2 in gastric epithelial cells [21,22] These results demonstrate the possible relations of the expression of PAR-2, the activation of MAPK, and apoptosis in...
- 7
- 399
- 0
Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx
... near the 5' (A) and 3' (B) ends of the M1 plus strands of 14 reovirus isolates Sequences near the 5' (A) and 3' (B) ends of the M1 plus strands of 14 reovirus isolates The start and stop codons ... length of 11, and a stringency of (B) Surface probability predictions of the T2J µ2 protein, determined as per Emini et al [73], using DNASTAR The predicted surface probability profiles of T1L and ... comparisons of T1L, T2J, and T3D Several types of genome-wide comparisons of T1L, T2J, and T3D have been reported previously [11] For this study we examined the positions and types of nucleotide...
- 17
- 379
- 0
báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx
... A and B was used, but included only MPTP-treated values and assigned value of for no treatment and 10, 30 and 50 for increasing dosage of valdecoxib The results were similar to those of A and ... Care and Use Committee at the University of Kentucky and are in strict accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals Genotyping of COX-2-deficient ... analysis as in E and F was used, but included only MPTP-treated values and assigned values of 1.0, 0.5 and 0.0 to COX-2 WT, HT and KO, respectively The results were similar to those of E and F with...
- 16
- 468
- 0
Báo cáo hóa học: " Deletion of human metapneumovirus M2-2 increases mutation frequency and attenuates growth in hamsters" potx
... cloning and recovery of the viruses MM and JG performed the immunization and challenge experiments in hamsters RS and RT contributed to experimental designs of the study and writing of the manuscript ... upstream of the native stop codon of M2-2, and was generated using the primer 5' CATAGAAATTATATATGTCAAGGCTTATTTAAATTAG and its complement Digestion with Swa I resulted in the removal of 142 nts of ... at an MOI of 0.1, and Northern blot analysis was performed in replicates The M2 and SH riboprobes each detected two RNA species from rhMPV-infected cells (Lanes 1, 3, and of Figure 5A and 5B) The...
- 14
- 435
- 0
Chapter 2: Lack of Planning and Fractured Management Undermine the State’s Tax Collection Efforts_part1 potx
... to conduct post audits of the transactions, accounts, programs, and performance of all departments, offices, and agencies of the State and its political subdivisions; and according to generally ... audits of the Department of Taxation to examine the department’s financial records and its systems of accounting and internal controls and tested these for compliance with applicable laws and regulations ... managers, and staff in the DoTAX, CGI, as well as the Office of the Governor, and other agencies, organizations, community groups, and individuals as required Our audit included a review of policies and...
- 11
- 387
- 0
Chapter 2: Lack of Planning and Fractured Management Undermine the State’s Tax Collection Efforts_part2 doc
... prioritization and coordination of all projects, reduces the risk of unexpected costs and project cancellations and helps ensure the value and quality of project deliverables In addition, the Institute of ... review and approval; change control; project plan updates and maintenance; issue tracking and management; document numbering and storage; meeting minutes; status reporting; and incident tracking and ... project manager, and a person of comparable standing from a department outside DoTAX The vendor’s members would include its project manager, area account manager, and one other individual of its choice...
- 11
- 413
- 0
Chapter 2: Lack of Planning and Fractured Management Undermine the State’s Tax Collection Efforts_part3 pdf
... redesign and acquisition of the new ITIM system The director was required to report to the Legislature the status of the contract and provide an accounting of all moneys appropriated and detailed ... and detailed information on the cost and benefits of implementing the automated tax systems, the amount of increased tax, interest, and penalties collected, and the amount paid to the vendor Act ... that the director of taxation shall be responsible for collection of all delinquent taxes and may select and retain bonded collection agencies, licensed attorneys, accountants, and auditors or...
- 11
- 389
- 0
Chapter 2: Lack of Planning and Fractured Management Undermine the State’s Tax Collection Efforts_part4 pdf
... responsibility of the board of directors and executive management It is an integral part of enterprise governance and consists of the leadership and organizational structures and processes that ... the tracking log Of the 13 incidents, several had balance differences of several hundreds of thousands of dollars, with the highest difference being in excess of $4.3 million As of July 2010, there ... the transition upon the completion of the 2009 modification is completed and results in a sustainable and ongoing support and maintenance of its IT systems; and d Better manage its future IT systems...
- 11
- 317
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008