... (25 mm) of cover, and ft (1500 mm) of length were cast Beams one and two were simply supported and loaded at a single location; and beams three and four were simply supported and loaded at two ... wound, and twilled), twisted-rod strand, tape, mesh, 2-D net, and 3-D web In the last ten years, research and development efforts have been reported in a number of technical presentations and publications ... [(610.3 gr/m2) and 24 oz/yd2 (813.7 gr/m2)] (see Fig 2.7) Mats—These are two-dimensional random arrays of chopped strands The fiber strands are deposited onto a continuous conveyor and pass through...
Ngày tải lên: 24/10/2014, 17:25
... melanogaster and Drosophila pseudoobscura and showed that these elements were also found preferentially near genes encoding transcription factors and developmental regulatory genes D melanogaster and ... transcription regulation and development in both H sapiens and C elegans Figure CNEs are associated with genes involved in transcription regulation and development in both H sapiens and C elegans The ... terms and these are the terms we have used in this paper GOslim term associations and counts for C elegans and human genes were calculated using the Perl script map2slim from the go-perl package and...
Ngày tải lên: 14/08/2014, 17:22
Tài liệu ELEMENTS OF Structural and Systematic Botany doc
... The nucleus is large and distinct in the larger species, and has a noticeably large and conspicuous nucleolus The most noticeable thing about the cell is the green spiral bands running around ... filament This branch becomes club-shaped, and the end somewhat pointed and more slender, and curves over This slender, curved portion is almost colorless, and is soon shut off from the rest of the ... picking up small sections and putting water in the slides; small forceps for handling delicate objects; blotting paper for removing superfluous water from the slides and drawing fluids under the...
Ngày tải lên: 13/02/2014, 12:20
Báo cáo hóa học: " Global behavior of 1D compressible isentropic Navier-Stokes equations with a non-autonomous external force" docx
... function and viscosity coefficient at free boundaries, see Yang and Zhao [10], Yang and Zhu [11], Vong et al [12], Fang and Zhang [13,14], Qin et al [15], authors studied the global existence and ... Theorem 3.1 and Lemma 4.2, implies t t ||utxx ||2 + ||utxxx ||2 (s)ds B1 (s)ds ≤ C2 (T) + ε (4:26) On the other hand, differentiating (1.9) with respect to x and t, and using Theorem 3.1 and Lemma ... initial data When f ≠ 0, Qin and Zhao [16] proved the global existence and asymptotic behavior for g = and μ = const with boundary conditions u(0,t) = u(1,t) = 0; Zhang and Fang [17] established...
Ngày tải lên: 20/06/2014, 22:20
Fundamentals of Structural Analysis Episode 1 Part 5 pdf
... Structures, by Yaun-Yu Hsieh and S T Mau, 4th edition, Prentice Hall, 1995, and Matrix Structural Analysis, by William McGuire and Richard H Gallagher, John Wiley and Sons, 1979 90 Truss Analysis: ... primary structure can be obtained by removing the supports at node c and node d Denoting the reaction at node c and node d as Rc and Rd, respectively, the original 86 Truss Analysis: Force Method, ... column and show all the internal as well as external forces acting on the element 93 Beam and Frame Analysis: Force Method, Part I by S T Mau M M T T V V Beam or column element with internal and...
Ngày tải lên: 05/08/2014, 09:20
Fundamentals of Structural Analysis Episode 1 Part 5 pps
... Structures, by Yaun-Yu Hsieh and S T Mau, 4th edition, Prentice Hall, 1995, and Matrix Structural Analysis, by William McGuire and Richard H Gallagher, John Wiley and Sons, 1979 90 Truss Analysis: ... primary structure can be obtained by removing the supports at node c and node d Denoting the reaction at node c and node d as Rc and Rd, respectively, the original 86 Truss Analysis: Force Method, ... column and show all the internal as well as external forces acting on the element 93 Beam and Frame Analysis: Force Method, Part I by S T Mau M M T T V V Beam or column element with internal and...
Ngày tải lên: 05/08/2014, 09:20
Fundamentals of Structural Analysis Episode 2 Part 5 pptx
... shape to those of a simply supported beam and are shown below together with the influence lines of FIJ, FCD, and FCJ which are obtained by cut -and- paste of and applying the proper factors to the ... (1) (2) Construct the influence lines of VbL and VbR of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b ... unit load at joint i is Si and the member force S due to a downward unit load at joint j is Sj, then the member force due to a unit load applied between joints i and j and located from joint i...
Ngày tải lên: 05/08/2014, 09:20
Fundamentals of Structural Analysis Episode 2 Part 5 pdf
... shape to those of a simply supported beam and are shown below together with the influence lines of FIJ, FCD, and FCJ which are obtained by cut -and- paste of and applying the proper factors to the ... (1) (2) Construct the influence lines of VbL and VbR of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b ... unit load at joint i is Si and the member force S due to a downward unit load at joint j is Sj, then the member force due to a unit load applied between joints i and j and located from joint i...
Ngày tải lên: 05/08/2014, 09:20
Fundamentals Of Structural Analysis Episode 1 Part 5 pptx
... Structures, by Yaun-Yu Hsieh and S T Mau, 4th edition, Prentice Hall, 1995, and Matrix Structural Analysis, by William McGuire and Richard H Gallagher, John Wiley and Sons, 1979 90 Truss Analysis: ... primary structure can be obtained by removing the supports at node c and node d Denoting the reaction at node c and node d as Rc and Rd, respectively, the original 86 Truss Analysis: Force Method, ... column and show all the internal as well as external forces acting on the element 93 Beam and Frame Analysis: Force Method, Part I by S T Mau M M T T V V Beam or column element with internal and...
Ngày tải lên: 05/08/2014, 11:20
Fundamentals Of Structural Analysis Episode 2 Part 5 pot
... shape to those of a simply supported beam and are shown below together with the influence lines of FIJ, FCD, and FCJ which are obtained by cut -and- paste of and applying the proper factors to the ... (1) (2) Construct the influence lines of VbL and VbR of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b ... unit load at joint i is Si and the member force S due to a downward unit load at joint j is Sj, then the member force due to a unit load applied between joints i and j and located from joint i...
Ngày tải lên: 05/08/2014, 11:20
the behavior of stock market prices eugene f fama the journal phần 5 pdf
... three different techniques for estimating a were discussed, illustrated, and compared The techniques involved double-log-normalprobability graphing, sequential computation of variance, and range analysis ... the random-walk model on successive price changes for differencing intervals of one, four, nine, and sixteen days The main techniques used were a serial correlation model, runs analysis, and -4lexander's ... variance and standard deviation will not tend to dampen nearly as much as would be expected with a Gaussian process Because of their extremely erratic behavior, the sample variance and standard...
Ngày tải lên: 09/08/2014, 20:20
The Behavior of Structures Composed of Composite Materials Part 5 pps
... the last terms on the left-hand sides of Equations (3.117) and (3.118) and are very seldom important in structural responses If they are neglected then and above, and the square of the remaining ... last term on the left-hand side of Equations (3.88) and (3.90) becoming and respectively, as shown below: 123 where is given by where is the mass density of the kth lamina, and here I is In Equations ... five equations associated with the inplane loads and and the in-plane displacements they cause, and These equations are give by (3.9), (3.10) and (2.66), for the case of mid-plane symmetry it...
Ngày tải lên: 10/08/2014, 12:21
Báo cáo khoa học: " Phylogenetic analysis of the non-structural (NS) gene of influenza A viruses isolated from mallards in Northern Europe in 2005" ppsx
... of the findings and revised the manuscript PT, GC and SB contributed to conception, interpretation of data, and revised the manuscript JW and BO developed the sampling design and directed the ... flyway, in Baltic island of Öland in southeast coast of Sweden (Figure 1) Birds were caught from October until the autumn migrations were ended in late December After banding and collection of biometrical ... of subtypes H1N2 and H3N2 and swine isolates of subtypes H3N2, while the K41 seem to be much more conservative in avian and equine isolates The absolute majority of human H1N2 and H3N2 viruses...
Ngày tải lên: 12/08/2014, 04:21
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5
... A., and Mehler, M.F (2009) Differential deployment of REST and CoREST promotes glial subtype specification and oligodendrocyte lineage maturation PLoS One 4, e7665 Abrous, D.N., Koehl, M., and ... B., Liu, M., and Shi, T (2011) Comparative analysis of human protein-coding and noncoding RNAs between brain and 10 mixed cell lines by RNA-Seq PLoS One 6, e28318 Chen, M., Zhang, J., and Manley, ... Z., and Ponting, C.P (2010) Long noncoding RNA genes: conservation of sequence and brain expression among diverse amniotes Genome Biol 11, R72 Chu, C., Qu, K., Zhong, F.L., Artandi, S.E., and...
Ngày tải lên: 09/09/2015, 17:55
SIMULATION OF DYNAMIC BEHAVIOR OF HOVERCRAFT HULL STRUCTURAL SUBJECTED TO UNDERWATER EXPLOSION SHOCKWAVE mô PHỎNG TÍNH TOÁN THUỘC TÍNH ĐỘNG lực học của mô HÌNH tàu đệm KHÍ dưới tác ĐỘNG SÓNG sốc gây RA bởi vụ nổ dưới nước
... ramps, and outboard sections housing main and auxiliary propulsion units, troop compartments, living quarters, and protection systems The Zubr hovercraft has a range of 480 kilometers at 100km/h and ... coupled BEM-FEM is used to handle the interaction of the composite structures and the underwater explosion bubble, mutual effects of relative location between the bubble and the composite submersible ... is class of aircushioned landing craft of Soviet design This class is the world’s largest hovercraft and built by Almaz Shipbuilding in St Petersburg High strength and buoyancy of the craft are...
Ngày tải lên: 08/06/2016, 14:11
New Insight into IELTS Student book with answers 2008 Answers - Part 5 out of 5.pdf
Ngày tải lên: 07/08/2012, 11:48
Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"
... alternative to flap based techniques7 -11 The bone graft techniques for the treatment of moderate to large OAC or OAF demonstrate to be innovative, successful and predictable and permit to avoid the ... performed with amoxicillin and clavulanic acid g The fixed partial prosthesis was removed and the contiguous mucosa appeared healthy A buccal full thickness flap was harvested and the presence of a ... appeared healthy, with normal color, consistence and no bleeding was present in the incision site and around the periodontal pockets of mesial and distal teeth The months control showed a normal...
Ngày tải lên: 25/10/2012, 11:48
The 5 lessons of startup
... customer needs and outcomes, and your solutions and evidence – what is compelling about your of f ering? Start with ten words and whittle it down Remember: your USP should be succinct and impactf ... inances – its projected income and outgoings You don’t need to be an accountant… get down to brass-tacks and understand what your business’s f inancial income and outgoings are going to look ... impactf ul # Done t he number-crunching [and sought t he right f inancing] A tough one, and certainly a topical issue these days However, not digging deep and ensuring your business has enough f...
Ngày tải lên: 18/08/2013, 12:02
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... #!!(),)## 1.23452/0267/8 '"# Figure Band intensities for Nitrobacter species While in Figure 4, the band intensities were high only in Runs and 7, and their band intensities were quite similar, ... with PCR and FISH By both of PCR and FISH analyses, only Nitrobacter species were detected The PCR result with FGPS primer set is shown in Figure The band intensitis were quantified, and were ... CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r...
Ngày tải lên: 05/09/2013, 09:38