2 method of approximate solution of a field in a transformer window with the help of fourier series
Analysis of transcription factors in living human cells with the help of split ubiquitin system
Ngày tải lên :
29/09/2015, 13:01
... domain and the other is activating domain which stimulates the activity of transcriptional apparatus Transcriptional activators can recruit chromatin modifying complexes such as the Swi/Snf and ... of a typical mammalian gene and a S cerevisiae gene have been described These contain the transcription start site, the TATA box, as well as certain upstream activating sequences (in yeast) and ... dyad axis (c) View as in (a) but rotated 90° around the horizontal axis looking down at the top of the molecule in a 30 of 110 amino acids that are conserved in many chromatin-associated proteins,...
- 124
- 346
- 0
Báo cáo toán học: "Using Boundary-Operator Method for Approximate Solution of a Boundary Value Problem (BVP) for Triharmonic Equation" ppsx
Ngày tải lên :
06/08/2014, 05:20
... , auδ )T as was mentioned in the beginning of the section Appendix Lemma Suppose A is a linear, symmetric and positive operator, P is a nonnegative operator in a Hilbert space H with the scalar ... Ω Taking into account the expression of Bz given by (5)-(6) and of B z by the ¯ same formula, where all the functions are marked with a bar over, we make transformations of the first intergral ... (32) Boundary-Operator Method for Approximate Solution of Boundary Value Problem 17 Scalarly multiplying both sides of the above equality by uδ and taking into account the nonnegativeness of P we...
- 9
- 247
- 0
báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt
Ngày tải lên :
20/06/2014, 16:20
... significantly higher levels of family life satisfaction and community satisfaction [35] Inhabitants of the affluent German South-West (BadenWuerttemberg, Bavaria, Hesse/Rhineland-Palatinate/Saarland, ... dissatisfaction with the individual MiL areas (range, 0–100, with higher scores reflecting higher satisfaction) To obtain a clear index varying from to 100, the satisfaction ratings si are recalculated ... Table 2: Areas of MiL listed by the respondents (n = 856) Included are number and percentage of the listings as well as mean and standard deviation (SD) of the importance and satisfaction ratings...
- 8
- 382
- 0
Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx
Ngày tải lên :
22/06/2014, 00:20
... mg catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a flow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for ... °C, the ID/IG increases with growth temperature In the former stage, SWCNTs are formed gradually with increasing growth temperature and the content of SWCNTs in the products increases In the latter ... The spectra show the ID/IG increasing rapidly with increasing growth temperature The TEM images show that SWCNTs are coated by more and more amorphous carbons, and when the temperature increases...
- 4
- 395
- 0
Báo cáo hóa học: "ON THE MEAN SUMMABILITY BY CESARO METHOD OF FOURIER TRIGONOMETRIC SERIES IN TWO-WEIGHTED SETTING" ppt
Ngày tải lên :
22/06/2014, 21:20
... norms and consider Theorem 3.2, we obtain the desired inequality Acknowledgments Part of research was carried out when the second author was visiting the Department of ă Mathematics at Balikesir ... repeat the last part of the proof of previous theorem Two-weighted Bernstein’s inequalities Applying the two-norm inequalities for the Cesaro means derived in the previous sections, we are able ... (3.6) In the sequel the set of all pairs with the condition (3.5) will be denoted by Ꮽ p (T2 , J) Here J denotes the set of all rectangles with parallel to the coordinate axes The proof of this theorem...
- 15
- 594
- 0
Báo cáo lâm nghiệp: "Variations in growth and virulence of Leptographium wingfieldii Morelet, a fungus associated with the bark beetle Tomicus piniperda L" pot
Ngày tải lên :
08/08/2014, 01:22
... delineated on transparent paper and then quantified by weighing the corresponding paper areas Percentages of blue stained sapwood area and healthy sapwood area were computed Each tree was characterized ... Within each ring, the inoculations were dispersed at equal intervals Each ring contained one replicate of each isolate and the replicates of a same isolate were located on opposite sides of the ... days later, the outer bark was removed around each inoculation point of the top ring and length of the reaction zone was measured on the external surface of the phloem The reaction zone in the...
- 9
- 308
- 0
Báo cáo khoa học: " eal-time ultrasound-guided catheterisation of the internal jugular vein: a prospective comparison with the landmark technique in critical care patients" pot
Ngày tải lên :
13/08/2014, 03:20
... avoid the carotid artery in these cases, a sideway approach of puncturing the IJV was used instead of the perpendicular approach It is of note that the most favourable outcomes associated with real-time ... triangle between the sternal and clavicular head of the sternocleidomastoid muscle was degreased with acetone and prepared in a sterile fashion with povidone-iodine Then, the area was anaesthetised ... trained and had at least years of experience in performing this method Data collection and statistical analysis Forms containing patients' characteristics and all the pertinent fields for each...
- 8
- 554
- 0
DSpace at VNU: Identification of the pollution source of a parabolic equation with the time-dependent heat conduction
Ngày tải lên :
16/12/2017, 03:46
... problem was studied in [] In [], the authors considered the heat source as a function of both space and time variables, in the additive or separable forms Many researchers viewed the source as a function ... function of space or time only In [, ], the authors determined the heat source dependent on one variable in a bounded domain by the boundary-element method and the iterative algorithm In [], the authors ... kind of equation () has many applications in groundwater pollution It is a simple form of advection-convection, which appears in groundwater Tuan et al Journal of Inequalities and Applications 2014,...
- 15
- 143
- 0
difficulties in teaching reading comprehension with the new english textbook “tieng anh 10” (the set of standard textbooks) to the 10th form students at ke sat high school
Ngày tải lên :
29/01/2014, 14:43
... read the passage again and scan the information about each area of change (Note: It is easy to recognize that the first paragraph is about the village many years ago, the second - the village ... hard to work with the reading passage and the reading task without their teacher’s careful explanation Many of them not have a habit of reviewing and preparing lessons at home Moreover, reading ... input This can help them to be acquainted with the theme and the language relating to the theme From then, the students can speak, listen and write about the things relating to the theme in the...
- 44
- 1.7K
- 8
Báo cáo hóa học: " Modulation of viral replication in macrophages persistently infected with the DA strain of Theiler''''s murine encephalomyelitis virus" docx
Ngày tải lên :
20/06/2014, 01:20
... treatment can result in the promotion of remyelination as well as in the aggravation of demyelination depending on the duration of the treatment Chemokines are chemotactic cytokines that are ... inhibitor of polio- and rhinovirus RNA synthesis that presumably targets a replication complex component that interacts with the viral protein 3A( B) [34], and neutralizing mAb raised against the capsid ... disease [51] In addition to its role as a chemoattractant, RANTES seems also important in viral clearance by mediating resistance against virus-induced death of macrophages [52] and its transcriptional...
- 10
- 269
- 0
Báo cáo y học: " Coronary arterial calcification in rheumatoid arthritis: comparison with the Multi-Ethnic Study of Atherosclerosis" pps
Ngày tải lên :
09/08/2014, 13:22
... missing score (hand or foot) was imputed from the available data based on a regression equation using data from the remaining subjects in the cohort Laboratory covariates Fasting sera and plasma ... the linear trend of increasing RA severity with CAC are < 0.05 for the total group and in all subgroup analyses in the prevalence of carotid plaque was observed in the RA patients younger than ... CAC On the other hand, finding that the association of RA status and CAC is only partially attenuated by IL-6 suggests the presence of additional RA-related mediators These might include a phenotypically...
- 12
- 380
- 0
Sodium valproate-induced congenital cardiac abnormalities in mice are associated with the inhibition of histone deacetylase ppsx
Ngày tải lên :
10/08/2014, 05:21
... RV: CCATCCGTCTCGGCTTTGT GATA4, FW: CTGTCATCTCACTATGGGCA; RV: CCAAGTCCGAGCAGGAATTT Tbx5, FW: CAAACTCACCAACAACCACC; RV: GCCAGAGACACCATTCTCAC MEF2C, FW: TAATGGATGAGCGTAACAGACAGG; RV: ATCAGACCGCCTGTGTTACC ... (Table 1) In addition, NaVP treatment caused a significant increase of cardiac abnormality rate in the treatment groups compared to the controls, with the highest cardiac abnormality rate in the ... (LV) of the heart, whereas the IVS in the heart of the control group is intact without any damage (Figure 2A) Since acetylation of histones H3 and H4 in mammalian cell nucleus plays a critical...
- 7
- 288
- 0
báo cáo khoa học:" Improvement of chronic facial pain and facial dyskinesia with the help of botulinum toxin application" ppt
Ngày tải lên :
12/08/2014, 00:20
... region In addition, a distinct cutaneous erythema appeared in the region of the dyskinesia (figure 1) Figure BTX -A The eczema in the affected area disappeared after injection of The eczema in the affected ... treatment with BTX -A Borodic et al [1] made the observation that the presence of erythematous patches or facial edema associated with severe pain has often been associated with the aggravation of ... Facial pain in a case of cranial dystonia: a case report Cephalalgia 1998, 18:709-711 Cheshire WP, Abashian SW, Mann JD: Botulinum toxin in the treatment of myofascial pain syndrome Pain 1994,...
- 5
- 246
- 1
Teaching for inquiry based learning at primary school level with the help of information technology
Ngày tải lên :
24/08/2015, 04:44
... overcoming the imposed way of indoctrinating and rot learning Focusing on teaching the way to learn, to think and encouraging self-study are the basis for the self-innovating and updating of knowledge, ... Inquiry-based learning in training and retraining of teachers; in program development and compilation of teaching materials - Trend 5: Researching teaching for Inquiry-based learning with the support ... grades and * Designing the exploration activities with the help of IT in Maths in grades and *Coordinating the exploration activities with the help of IT and using the traditional belongings in Maths...
- 26
- 387
- 1
Can students learn more information quickly with the help of new technologie1
Ngày tải lên :
27/08/2016, 11:01
... today are forgetting what is really important in our life ...
- 2
- 341
- 1
skkn MOTIVATING STUDENTS IN ENGLISH CLASS WITH THE HELP OF ENGLISH SHORT CLIPS
Ngày tải lên :
05/09/2017, 15:44
... as a listening task, or as a sum-up activity at the end of each unit This depends as whether the teacher wants to use the clip as a catchy introduction to a new lesson, as a part clarifying an ... students in different classes and their feedbacks are, to a certain extent, positive The students all agree that with the audio and visual effects, these clips can instantly grab their attention In addition, ... benefits of using authentic materials in the classroom, according to Philip, Shettlesworth, and Clarke (as cited in Richards, 2001), there are a few that are worth considering: “they [authentic materials]...
- 14
- 404
- 1
2.1.4.7 Lab - Establishing a Console Session with Tera Term - ILM
Ngày tải lên :
15/12/2017, 18:27
... to access the terminal output of the switch It also allows you to configure the switch a Start Tera Term by clicking the Windows Start button located in the task bar Locate Tera Term under All ... device The table does not include any other type of interface, even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal ... Router Interface Summary Table Router Interface Summary Router Model Ethernet Interface #1 Ethernet Interface #2 Serial Interface #1 Serial Interface #2 1800 Fast Ethernet 0/0 (F0/0) Fast Ethernet...
- 11
- 816
- 1
Examples of Fourier series
Ngày tải lên :
16/12/2017, 07:57
... of Fourier series A general remark In some textbooks the formulation of the main theorem also includes the unnecessary assumption that the graph of the function does not have vertical half tangents ... Fourier series in the theory of beams 115 www.sylvania.com We not reinvent the wheel we reinvent light Fascinating lighting offers an ininite spectrum of possibilities: Innovative technologies and ... international career paths Implement sustainable ideas in close cooperation with other specialists and contribute to inluencing our future Come and join us in reinventing light every day Light...
- 119
- 120
- 0