... 10.9 Part II Using a Physical Standby Database with a Time Lag Establishing a Time Lag on a Physical Standby Database Failing Over to a Physical Standby Database with a Time Lag ... the standby database Similar to a primary database, a standby database can be either a single-instance Oracle database or an Oracle Real Application Clusters database A standby database can be ... either a physical standby database or a logical standby database: s Physical standby database Provides a physically identical copy of the primary database, with on disk database structures that are...
Ngày tải lên: 17/01/2014, 06:20
... highlight that participation status over this time period changes for some adults and remains stable for others These overall figures conceal substantial contrasts in the patterns of change with age ... stratified by age group and gender In individuals with participation restriction at baseline, estimates of persistence within each of the 11 aspects of life were calculated overall, and by age and ... older adults, we have shown that there is a substantial degree of change in participation status over a three-year period Nearly 30% of those who were participating "as and when they wanted" in all...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo lâm nghiệp: "Evaluation of squared timber and log products in the Hyrcanian Forests of Iran" doc
... Located in the northern part of Iran, the study areas are known as the Northern Forests or Hyrcanian Forests and are distributed across three provinces: Golestan, Mazandaran, and Gilan The majority ... bucking operations are carried out by manual chainsaws; however, logs are extracted by skidders from forest stands to a yard near the main road (Fig 3) As K (2007) indicated, from 1997 to 2002 ... monitored at the same time The relationships between squared timber and log products during the last 20 years (1989–2008) were evaluated using statistical software such as SPSS (Statistical Package...
Ngày tải lên: 07/08/2014, 10:21
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... ture at 2.8 A resolution of cytochrome c oxidase from Paracoccus denitrificans Nature 376, 660–669 12 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, ... the chromatographic steps of the standard purification procedure (see Materials and methods): prior to gel filtration, the partially purified material was incubated with a large excess of Triton X-100, ... four-subunit cytochrome c oxidase was purified by conventional chromatographic protocol as described in [21]; the oxidase complexed with an antibody fragment (Fv) was isolated in a single chromatographic...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine All clones expressing ChiB variants ... 22 pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based ... reaction pathway of cyclodextrin glycosyltransferase elucidate catalysis in the alpha-amylase family Nat Struct Biol 6, 432–436 Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai, A. ,...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx
... conformational change in aspartate aminotransferase after substrate binding, which promotes the catalytic reaction, as it favors maximum imine–pyridine conjugation Aspartate aminotransferase is also a ... M., Hara, M., Mai, L., Numayama-Tsuruta, K., Ishigaki-Suzuki, S., Ohuchi, K., Ichikawa, A. , Falus, A. , Watanabe, T & Nagy, A (2001) Mice lacking histidine decarboxylase exhibit abnormal mast cells ... process similar to that occurring in the transaminase could lead to a more severe rotation in angle v up to negative values [19], so that these conformational changes are related to the catalytic efficiency...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf
... 5¢-GCCACT TACTTGAACTTTGACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGCATTTGACATAGAAGCC-3¢, 5¢-GCCACT TACTTGGACTTTAACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGACTTTGCGATAGAAGCCGG-3¢, 5¢-GGAC TTTGACATACAAGCCGGTATCGATGC-3¢, ... B-factor values ˚ All atoms (A2 ) ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) ˚ Substrate (A2 ) ˚ Water (A2 ) R.m.s DB values ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) Ramachandran plot statisticsf Favored (%) Allowed ... natural product cyclopentapeptide inhibitors against A fumigatus, human, and bacterial chitinases Chem Biol 12, 65–76 Watanabe T, Ariga Y, Sato U, Toratani T, Hashimoto M, Nikaidou N, Kezuka Y,...
Ngày tải lên: 15/03/2014, 11:20
Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx
... of the ANME-1 cluster, there is a codon for a valine, whereas in mcrA from methanogenic archaea, there is a codon for a glutamine [2] 4914 Methanogenic archaea and methanotrophic archaea all belong ... essential in Methanosarcina acetivorans C 2A and allows isolation of mutants with defects in regulation of the methanol utilization pathway J Bacteriol 187, 5552–5559 14 Metcalf WW, Zhang JK, Apolinario ... of Methanosphaera stadtmanae reveals why this human intestinal archaeon is restricted to methanol and H2 for methane formation and ATP synthesis J Bacteriol 188, 642–658 18 Jaun B & Thauer RK...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
... 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ ... 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ ... 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ 5¢-GACTAGAAGCGGGAACGCCATACGGA-3¢...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... 269) overlaps to Y224 of the mammalian enzyme (the residue interacting with the a- amino group of the substrate and with a buried water molecule) Y224 in pkDAAO and Y238 in RgDAAO share the characteristics ... mutants have a similar substrate specicity to the with wild-type DAAO: the highest Vmax/Km ratios have been observed with D-phenylalanine and D-tryptophan Like the wild-type DAAO, basic D-amino acids ... in substrate/product exchange to the active site of RgDAAO A superimposition of the active sites of yeast and mammalian DAAO [24] shows that the side chain of Y223 of RgDAAO overlaps with the...
Ngày tải lên: 17/03/2014, 17:20
Report Development Tools Building Custom Reports in the R/3 System
... of SAP AG SAP AG makes no warranties or representations with respect to the content hereof and specifically disclaims any implied warranties of merchantability or fitness for any particular purpose ... Development Tools xiii Detailed Table of Contents Running an OIW Report With Automatic Update C–15 Running an OIW Report Without Automatic Update/Calculation C–17 Saving and Running an OIW ... Pair Group) Margie Coolidge, Ron Giovannelli, and Patrick Zalamea (Ziatech Corporation) Pamela Anderson and Robert Smith (publishing consultants) Werner Aigner, Simone Baeumer, Tami Becker, Randi...
Ngày tải lên: 27/10/2013, 07:15
Fill in the gaps 3
... writing, and to avoid contractions such as 'isn't' and 'doesn't' k …materials such as nylon as well as natural materials such as cotton l …it is unlikely that man will be able travel to other galaxies ... for the past six years Although the factory had to be closed, all the employees were relocated to another factory belonging to the same company Some organisations have a dress ... usually stop / suppress any newspaper reports which contain bad news 10 Examination candidates are not allowed to eat, drink, smoke or talk for the time / duration of the examination 11 The UK Government...
Ngày tải lên: 02/11/2013, 10:20
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 3 docx
... exploratory factor analysis with varimax rotation was conducted on the 18 measures The factor analysis revealed four factors and explained 64.36% of the variance in the data Table shows the factor loadings ... the table The alpha values are greater than 0.6 indicating that the items in each factor belong together Table also contains labels that the author applied to the factors Deterrent and remedial ... about trust, and finally have a procedure/protocol to deal with trust anomalies, both perceived and actual RECOMMENDATIONS FOR MANAGERS TO REINFORCE TRUST IN THE WORKPLACE Managers are constant...
Ngày tải lên: 24/12/2013, 18:15
Tài liệu Color Atlas of Pharmacology (Part 3): Distribution in the Body docx
... Extracellular Phagolysosome Intracellular Extracellular C Membrane permeation: receptor-mediated endocytosis, vesicular uptake, and transport Lüllmann, Color Atlas of Pharmacology © 2000 Thieme All ... substance and and Solid substance structurally bound water structurally bound water 40% 20% 40% intracellular intracellular water water extra-cellular extracellular water water Potential aqueous ... order to reach their sites of action, they must leave the bloodstream Drug permeation occurs largely in the capillary bed, where both surface area and time available for exchange are maximal (extensive...
Ngày tải lên: 22/01/2014, 00:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC ... GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298 PAI-2) Reverse (nt 1860–1843 PAI-2) Forward (nt 1491–1508 PAI-2) Reverse...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf
... in AD There are numerous pathological hallmarks in AD that are commonly accompanied by neuronal alterations These physical alterations include aberrant neurite sprouting and significant neuronal ... neurotrophic activity of the AD brain revealed that it correlated with the loss of a specific neuroinhibitory factor, rather than the presence of a neurotrophic factor This factor was later isolated and ... injured and degenerative brain C Howells et al extracellular senile amyloid plaques These physical alterations are often accompanied by aberrant neurite sprouting and significant neuronal loss, particularly...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... to the lack of a transmembrane region, i.e an inability to dramatically lower the Km, it cannot exert the same dramatic impact on FX activation When G372AFVIIa was bound to lipidated TF, FX activation ... factor VIIa E Persson and O H Olsen A B Fig PABA inhibition of G37 2A- FVIIa and FVIIa bound to sTF The residual amidolytic activity of G37 2A- FVIIa (d) and FVIIa (s), saturated with sTF, when at ... accession number 1j 8a) with Asn in this position, albeit with F,W angles far from the allowed Ramachandran region, are virtually identical to that of FVIIa Modelling of Ala372(223) into FVIIa...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... NADPH, and glutamate dehydrogenase were from Wako Pure Chemicals (Osaka, Japan); meat extract (Extract Ehlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentafluorophenylhydrazine was from ... [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... the narrow substrate specificity and the cofactor References Hasegawa, Y., Muraki, T., Tokuyama, T., Iwaki, H., Tatsuno, M & Lau, P.C (2000) A novel degradative pathway of 2-nitorobenzoate via 3-hydroxyanthranilate...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... D A A A A A A A A A A S S S S S S S S S S H H H H H H H H H H R R R R R R R R R R D D D D D D D D D D L L L L L L L L L L AthalianaB 199 199 PativumB SoleraceaB 199 NtabacumB 199 A. thalianaA...
Ngày tải lên: 19/02/2014, 16:20