17 t lymphocytes in sle patients upon ex vivo activation
Báo cáo y học: " Pathogenic effect of interleukin-17A in induction of Sjögren’s syndrome-like disease using adenovirus-mediated gene transfer" docx
Ngày tải lên :
12/08/2014, 15:22
... done with rabbit IgG The slides were incubated with biotinylated goat anti-rabbit IgG followed by horseradish peroxidaseconjugated strepavidin incubation using the Vectastain ABC kit The staining ... concomitantly, leukocyte infiltration in the exocrine glands is often observed at these ages [32,33] Thus, it is important to examine the role of IL17A in the development of SS prior and post to ... the T H 17/ IL-17A system is considered to be an important factor in innate immunity that, in turn, regulates development of the adaptive immune response, it is not surprising that environmental...
- 11
- 276
- 0
Báo cáo y học: " Attenuated allergic airway hyperresponsiveness in C57BL/6 mice is associated with enhanced surfactant protein (SP)-D production following allergic sensitization" pdf
Ngày tải lên :
12/08/2014, 18:21
... (ABPA), SP-D treatment protected against mortality and inhibited the immunoglobulin, eosinophil and Th2 cytokines associated with this model of fungal infection [35,36] Th2 cytokine levels in the BAL ... To that end, it is of interest that analyses of the murine IL-9 gene identified a genetic defect at the IL-9 locus in C57BL/6 mice [2] To investigate the association of BAL SP-D levels with the ... asthma Demonstration of strain differences in susceptibility to develop AHR to allergic sensitization has long been intriguing and promoted the use of inbred mouse strains for the investigation...
- 12
- 210
- 0
Báo cáo khoa học: b3-Adrenoceptor knockout in C57BL/6J mice depresses the occurrence of brown adipocytes in white fat pptx
Ngày tải lên :
23/03/2014, 20:22
... the beginning of each experiment They were then divided into three groups, one maintained at 24 °C and the other two exposed to cold (6 °C) for either two or 10 days The fat pads along the uterus ... level of the b1-adrenoceptor mRNA in BAT or WAT Our in vivo studies are in contrast with in vitro experiments performed in cultivated adipocytes of male mice suggesting that UCP1 mRNA expression ... hypothesis deserves further studies Together, our results suggest that the brown adipocytelike cells present in WAT and the brown adipocytes constituting BAT are subjected to different control...
- 7
- 368
- 0
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
Ngày tải lên :
09/08/2014, 10:21
... of inflammatory cell infiltration in the two strains In contrast, in late arthritis (6 to weeks after onset), inflammatory cell infiltration Page of (page number not for citation purposes) Arthritis ... therefore, an increasing need to model the anti-arthritic effects of methotrexate in combination with other therapies in order to optimise treatment regimens and to identify possible interactions Likewise, ... as methotrexate Competing interests The authors declare that they have no competing interests uted to the preparation of the manuscript All authors read and approved the final manuscript Acknowledgements...
- 8
- 372
- 0
Báo cáo y học: "Response of the mouse lung transcriptome to welding fume: effects of stainless and mild steel fumes on lung gene expression in A/J and C57BL/6J mice" pot
Ngày tải lên :
12/08/2014, 11:22
... expression patterns within this strain to these welding fumes; this was in contrast to the A/J strain (see panel A) By 16 weeks post-exposure, 35 annotated genes resulted in distinct subclusters ... slanted board in a dorsal recumbent position The tongue was extended with forceps and the solution was pipetted to the oropharynx The tongue was held extended until the solution was aspirated into ... genes, including NR1D1, following cigarette smoke exposure [21] These findings suggest that this particular gene subset may be important in the lung response to toxic stimuli weeks post-exposure to...
- 18
- 382
- 0
báo cáo hóa học: " Treatment with gelsolin reduces brain inflammation and apoptotic signaling in mice following thermal injury" potx
Ngày tải lên :
19/06/2014, 22:20
... expression in brain during the entire observation period, suggesting that administration of gelsolin only inhibits proinflammatory cytokine transcription, without augmenting expression of anti-inflammatory ... activation in gelsolin-treated animals were found to be associated with down-regulation of proinflammatory cytokines and caspase-3 activities Taken together, these results indicate that treatment ... contribute to reduced post-burn mortality While these studies are intriguing, there are several limitations that should be addressed in future investigations The first shortcoming is that clinical...
- 18
- 276
- 0
Báo cáo khoa học: "Mucosal mast cell-derived chondroitin sulphate levels in and worm expulsion from FcRγ-knockout mice following oral challenge with Strongyloides venezuelensis" doc
Ngày tải lên :
07/08/2014, 18:20
... chondroitin sulphates released into the gut lumen, suggesting that the sugars are intimately associated with worm expulsion It is our opinion that extensive further studies into the role of sulphated ... hostile intestinal environment in primed KO and WT mice would most likely result in a patent infection in the former but not in the latter Results of this study largely support our predictions ... First, significantly higher concentrations of chondroitin sulphates were present in gut washings of WT, in which the challenge infection was sterile than in KO, in which persistent patent infection...
- 6
- 222
- 0
Báo cáo khoa học: "Concurrent response to challenge infection with Cryptosporidium parvum in immunosuppressed C57BL/6N mice" pdf
Ngày tải lên :
07/08/2014, 18:21
... egnellahc a ot tnatsiser erom si muvrap C htiw detcefni ecim N6/LB75C tluda eht taht etartsnomed stluser eseht ,suhT noitcefnier eht tsniaga noitcetorp etaredom a evah stcartxe muvrap C elohw eht dna ... ecim ehT yad ht52 eht litnu stsycoo dehs ton did puorG syad ht52 ot ht5 eht no ralimis yrev erew dna puorg neewteb seitisnetni gniddehs tsycoO tnemirepxe yad-04 eht noitarud eht tuohguorht stsycoo ... muvrap C eht taht etacidni stluser esehT yad ht01 eht no naht yad ht04 eht no rehgih erew spuorg eseht fo sretit ASILE eht ,eromrehtruF spuorg rehto morf tnereffid ton erew puorg noitaluconi tsycoo...
- 5
- 249
- 1
Báo cáo khoa học: "Anti-obesity activity of diglyceride containing conjugated linoleic acid in C57BL/6J ob/ob mice" potx
Ngày tải lên :
07/08/2014, 23:22
... group, indicating that their effects were not relevant to the daily feed intake The PPAR-γ, CC/AAT/enhancer binding protein α, and fatty aP2 are transcription factors known to be important in adipocyte ... humans [33] The objective of the present study was to investigate the anti-obesity effects of DG, CLA and DG-CLA containing 22% CLA as fatty Anti-obesity effect of CLA-containing diglyceride in obese ... oxaloacetic transaminase (GOT), γ-glutamatepyruvate transaminase (γ-GPT), blood urea nitrogen (BUN), and creatinine (CRE) were determined Abdominal fat weight Abdominal fats including mesentery,...
- 7
- 246
- 0
Báo cáo y học: " PCEP enhances IgA mucosal immune responses in mice following different immunization routes with influenza virus antigens" pdf
Ngày tải lên :
11/08/2014, 08:21
... involved with critical analysis of the intellectual content All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: ... the idea that the depot effect does not contribute to mucosal adjuvant activity of PCEP Most mucosal adjuvants promote mucosal immunity by 1) acting through pattern recognization, like TLR, to ... gastrointestinal tract is a very harsh environment for many antigens due to low pH in the stomach, digestive enzymes in intestines, and peristaltic movements However, in this study, oral immunization...
- 11
- 443
- 0
báo cáo hóa học: " Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury" pptx
Ngày tải lên :
19/06/2014, 22:20
... assess the functional state of astrocytes after traumatic brain injury, we analyzed the expression of two glutamate transporters, glutamate aspartate transporter (GLAST) and glutamate transporter-1 ... Immunohistochemical localization of interleukin-1beta, interleukin-1 receptor antagonist and interleukin-1beta converting enzyme/caspase-1 in the rat brain after peripheral administration of kainic ... PAR-1 expression in astrocytes during HIV encephalitis [58] Our findings suggest that blocking IL-1 signaling via IL-1R1 may attenuate the activation of PAR-1 after brain injury To determine which...
- 11
- 402
- 0
báo cáo hóa học: " Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharide" ppt
Ngày tải lên :
19/06/2014, 22:20
... GPE Thus it appears that IGF-I has the potential to generate two distinct signaling events that result in anti-depressant activity; an IGF-1R mediated action and an IGF-1R independent GPE-mediated ... attenuated In conclusion, data in this manuscript show that exogenous central administration of either IGF-I or GPE results in anti-depressant-like activity, assessed using the TST and FST The ... Overall, these data indicate that glial activation is suppressed by central GPE, offsetting the inflammatory response initiated by i.p LPS 14 GPE administration does not regulate expression of tryptophan...
- 38
- 340
- 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
Ngày tải lên :
20/06/2014, 01:20
... present study contains a disrupted thymidine kinase gene due to the M2 insert [10] This disruption has been shown to result in attenuation compared to its strain WR parent, yet the virus still causes ... viral titers in the tissue were determined by plaque titration of lung homogenates In animals infected by the IN route, the following titers (log10 PFU per g of lung tissue) were detected in the two ... of tetramer+CD8+ cells was detected in the lungs after IN infection with VV-M2 Interestingly, despite the lack of VV-M2 replication in the lungs after ID inoculation, a high level (21%) of tetramer+CD8+...
- 8
- 381
- 0
Báo cáo khoa học: "Regional Distribution and Relative Frequency of Gastrointestinal Endocrine Cells in Large Intestines of C57BL/6 Mice" potx
Ngày tải lên :
07/08/2014, 15:20
... It is known that somatostatin-IR cells show have the widest distribution in the whole GIT except for the large intestine of all vertebrate species investigated, including 37 primitive agnathans ... the large intestinal tract in various numbers according to each portion of the large intestinal tract and had the highest frequency in the colon (Table 2) In the cecum, they were found in either ... cells in the large intestinal tract of C57BL/6 mice Note the various distributions and relative frequencies of these cells throughout whole large intestinal tract These cells were detected in the...
- 6
- 339
- 0
Báo cáo khoa học: "In vitro characterization of cells derived from chordoma cell line U-CH1 following treatment with X-rays, heavy ions and chemotherapeutic drugs" pdf
Ngày tải lên :
09/08/2014, 09:21
... (TOYOBO, Japan) with the following primers: hTP53AF (5’ccattcttttcctgctccacaggaagccga-3’) and hTP53BR (5’ggctaagctatgatgttccttagattaggt-3’) for exons - 9, hTP53CF (5’-ctgtataggtacttgaagtgcagtttctac ... near future Nonetheless, this is the first report presenting the extensive in vitro cellular studies including radiation and chemical cell survival/ toxicity curves with the cell line originating ... gene, although our sequence result exhibited a heterozygous mutation C > G, causing an amino acid substitution of proline 72 to arginine (Figure 1) Since the substitution has not been reported to...
- 9
- 377
- 0
Sodium valproate-induced congenital cardiac abnormalities in mice are associated with the inhibition of histone deacetylase ppsx
Ngày tải lên :
10/08/2014, 05:21
... 2010, 17: 16 http://www.jbiomedsci.com/content /17/ 1/16 HDAC2, FW: GACATATGAGACTGCAGTTGC; RV: ACCTCCTTCACCTTCATCCTC Nkx2.5, FW: CACCCACGCCTTTCTCAGTC; RV: CCATCCGTCTCGGCTTTGT GATA4, FW: CTGTCATCTCACTATGGGCA; ... abnormalities in fetal hearts, which is likely associated with an inhibition of histone deacetylase without altering the transcription of this enzyme Competing interests The authors declare that they ... pattern of Tbx5 in the heart is very interesting It is uniformly expressed throughout the entire cardiac crescent early in the developing heart With the development of the heart, Tbx5 is asymmetrically...
- 7
- 288
- 0
Báo cáo y học: "Hand-grip strength is a simple and effective outcome predictor in esophageal cancer following esophagectomy with reconstruction: a prospective study" ppt
Ngày tải lên :
10/08/2014, 09:22
... tube drainage in 5, anastomotic leak in and other conditions in patients Surgical mortality was found in patients patients died within months after radical operation The mean duration to start regular ... Figure The hand-grip strength in mortality and survived patients was stratified according to age The mean hand-grip strength in mortality patients is significantly lower than survived patients in the ... requiring elective esophagectomy with reconstruction The results of the hand-grip strength did not indicate any specific physiology defect that other tests fail to detect In contrast, the results...
- 5
- 426
- 0
Báo cáo y học: " Neuroprotective peptide ADNF-9 in fetal brain of C57BL/6 mice exposed prenatally to alcohol" pptx
Ngày tải lên :
10/08/2014, 10:20
... complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function Cytoplasmic dynein acts as a motor for the intracellular retrograde motility ... minutes in the dark A second aliquot of DTT was then added to the sample, bringing the final concentration of DTT to 10 mM The samples were then incubated at room temperature for 30 minutes to ... complex is involved in mRNA export from the nucleus via its interaction with THOC4/ALY, leading to the recruitment of the mRNA export machinery to the 5’ end of mRNA and to mRNA export in a 5’ to...
- 12
- 312
- 0
Báo cáo y học: " Improvement of platelet dysfunction in chronic myelogenous leukemia following treatment with imatinib: a case report" pps
Ngày tải lên :
10/08/2014, 23:21
... single-agent treatment strategy with imatinib in an outpatient setting No further episodes of bleeding occurred during the follow-up of the patient During that time, the patient underwent dental ... his left buttock A clinical examination revealed massive swelling that was extremely tender to touch The increasing pain necessitated the use of continuous intravenous morphine Computed tomography ... platelet counts, platelet transfusions were initiated Following the platelet substitution, his bleeding ceased quickly The patient could be discharged 10 days later At that time, the patient had...
- 4
- 390
- 0
Báo cáo y học: "Macrophage pro-inflammatory cytokine secretion is enhanced following interaction with autologous platelets" pdf
Ngày tải lên :
11/08/2014, 03:20
... following addition of platelets or apoptotic cells to LPS-stimulated hMDMs Autologous platelets in two different activation states were used in the coculture experiments: platelets that were “partially ... which the platelets were in a truly resting state Nonetheless, the interaction involving activated platelets is relevant because platelets are most likely activated at sites of tissue injury and ... activated platelets in the same way that they clear aged platelets The finding that phosphatidylserine exposure is not a requirement for phagocytosis of AAPs in the present study was somewhat...
- 9
- 269
- 0