14—piston rod run out is a key criterion for recip compressors

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Ngày tải lên : 30/03/2014, 04:20
... Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen species not mediate NF-kappaB activation EMBO J 22, 3356–3366 Yang ... extracellular matrix degradation (matrix metalloproteases) [75–78] In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and continuous activation ... Sovak MA, Zanieski G, Nonet G, RomieuMourez R, Lau AW, Hafer LJ, Yaswen P, Stampfer M, Rogers AE et al (2000) Activation of NF-kappaB ⁄ Rel occurs early during neoplastic transformation of mammary...
  • 12
  • 390
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Ngày tải lên : 30/03/2014, 20:20
... sequence and dimeric structure Agric Biol Chem 55, 73–86 Kawakami A, Kataoka H, Oka T, Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa H, Suzuki A & Ishizaki H (1990) Molecular cloning ... for the entire somata (S) of the brain Fluorescence images were converted to grayscale and inverted into black and white images An area adjacent to the area of interest (A) and an area from an ... multicellular organisms [15] There are four isoforms (A D) of mammalian MEF2, and they have high homology within the 56-amino-acid MADS box at their N-termini and within an adjacent 29-amino-acid region...
  • 10
  • 437
  • 0
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

Ngày tải lên : 14/08/2014, 20:22
... NCOA3-D NR 4A3 -A NR 4A3 -B NR 4A3 -C PCAF -A PCAF-C PDGFRA -A PDGFRA-B PDGFRA-C PKD1 -A PKD2 -A PKD2-B PKD2-C PKD2-D PPARA -A PPARA-B PPARA-C PPARA-D PPARA-E PPARA-F PPARA-H PTEN -A RB1 -A RB1-B RB1CC1 -A ... FOXO 1A- C FOXO 1A- D FOXO 1A- E FOXO 1A- F GAB1 -A HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C ... Cordon-Cardo C, Lowe SW, Hannon GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe...
  • 14
  • 331
  • 0
Mobility is a key predictor of change in well being among older adults who experience falls  evidence from the vancouver falls prevention clinic cohort

Mobility is a key predictor of change in well being among older adults who experience falls evidence from the vancouver falls prevention clinic cohort

Ngày tải lên : 25/08/2016, 22:07
... Physiological falls risk was assessed using the short form of the Physiological Profile Assessment (PPA) 156 The PPA is a valid and reliable [60] measure of falls risk Based on a participant’s performance ... Scholarship recipient JCD and JB are funded by a CIHR and MSFHR Postdoctoral Fellowship LL is a MSFHR Scholar and a Canada Research Chair CLS is a CIHR Doctoral Trainee M AN U These funding agencies ... Neuroscience, a Michael Smith Foundation for Health Research (MSFHR) Scholar, a Canadian Institutes of Health Research (CIHR) New Investigator, and a Heart and Stroke Foundation of Canada’s Henry JM SC Barnett’s...
  • 29
  • 342
  • 0
Tài liệu De-interlacing A Key Technology for Scan Rate Conversion doc

Tài liệu De-interlacing A Key Technology for Scan Rate Conversion doc

Ngày tải lên : 10/12/2013, 14:15
... The spatiotemporal information contained in this video is ordered as a function of time according to a predefined scanning format This scanning format, which is a major part of a video standard, ... nowadays Although the literature provides evidence that an all-progressive chain gives at least as good an image quality as an all-interlaced chain with the same channel bandwidth, recent research ... show a variation in resistance As such, variation in light can be transformed into a variation of an electrical signal, and therefore, be transmitted One of the earliest methods of scanning a picture...
  • 369
  • 428
  • 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Ngày tải lên : 15/02/2014, 01:20
... Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratasereactivating factor in ADP-bound and nucleotide-free forms ... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase activity ... it can be assumed that the reactivase mediates the exchange of enzyme-bound damaged cofactor for intact AdoCbl with a rate constant (kcat,cbl-release) of 0.14 min)1 This value is about half of...
  • 13
  • 620
  • 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Ngày tải lên : 19/02/2014, 05:20
... of anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purification of FN3d–AP was carried out using an AKTA ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated...
  • 14
  • 669
  • 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... Zymed (San Francisco, CA, USA) Horseradish peroxidaseconjugated goat anti-(mouse IgG) and gel-filtration standards were from Bio-Rad Laboratories (Hercules, CA, USA) Penta His mAb and Ni-NTA agarose ... the AAA superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase...
  • 23
  • 490
  • 0
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Ngày tải lên : 16/03/2014, 18:20
... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... ligand for LESTR ⁄ fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 382, 833–835 1950 N Charnaux et al Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, ... imager after autoradiography scanning For each sample, data were expressed as a ratio of p44 ⁄ p42 MAPKs- or SAPK ⁄ JNK-phosphorylated proteins over total proteins, in absorbance units The mean...
  • 15
  • 423
  • 0
Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx

Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx

Ngày tải lên : 23/03/2014, 13:20
... 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ a Second primer for all of the above 5¢-GTCATTAATCCAACGGTCATCCCA-3¢ Primers used for ... 5¢-GTGGAGGACAGCTATGGGCAGCAG-3¢ Wild type Asp893fiArg 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle ... properties, although in somewhat different ways In general, however, we can distinguish between catalytically inactive and catalytically active mutants Catalytically inactive mutants All mutants of Asp893...
  • 11
  • 318
  • 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Ngày tải lên : 31/03/2014, 23:20
... or His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity ... plays an important role in the rRNA catalytic cleavage by a- sarcin, which would not be simply related to the bearing positive charge Both mutant variants of a- sarcin cleave ApA, with slight variation ... proposed that the mechanism of action of a- sarcin against ribosomes might differ in some details from that against dinucleotides [18,19] The behaviour of a- sarcin against ApA as a function of pH, altogether...
  • 7
  • 434
  • 0
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

Ngày tải lên : 21/06/2014, 17:20
... DNA-shift assay PSEx1 PEx1R simA7F CCATGTAGGCGGTGACGA TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay PA7 simA7R ATAAGCTTGTCGATACCGATCTTC DNA-shift assay PEx2 DNA-shift assay PSR3 PEx2F ACTTCCCAGAAGTA ... TAGAATTCATCGCCACGACCATG SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay PD3 simX5D3R simEXX4F TAGAATTCGCGACAGGAGCCATA TAGAATTCGACGCCTTCCAGTC DNA-shift assay PX4 simEXX4R TAGAATTCTCAGAACATCGTCC ... ATACCATGGCCCGTGAACGT SimReg1 simReg1 SSR1R TTTGAATTCATTAATGGTGATGGT purification DNA-shift assay PD4 DNA-shift assay PR1 SR1D4F TAGAATTCGTGAGCAGATCATGT SR1D4R TAGAATTCCATTGTGAACCATC SD2R1F TAGAATTCATCGCCACGACCATG...
  • 12
  • 454
  • 0
Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps

Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps

Ngày tải lên : 09/08/2014, 01:21
... Tsuchiya KJ, Takagai S, Kawai M, Matsumoto H, Nakamura K, Minabe Y, Mori N, Takei N: Advanced paternal age associated with an elevated risk for schizophrenia in offspring in a Japanese population Schizophr ... rare human disease has prompted research on complex common disease to focus on genetic approaches Table Sample classes as a function of parental or maternal age at birth Group Parental age at ... order/rank and schizophrenia may be due to paternal age In fact, as advanced paternal age was a risk factor for schizophrenia, the disease frequency was greater in children with higher birth rank as...
  • 6
  • 405
  • 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Ngày tải lên : 09/08/2014, 23:20
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC t p.G60V ... Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... manuscript SL and TS evaluated and interpreted SNP microarray and aCGH data All authors read and approved the final manuscript for publication Acknowledgments We thank the heterotaxy patients and families...
  • 36
  • 446
  • 0
Báo cáo y học: "Aboriginal status is a prognostic factor for mortality among antiretroviral naïve HIV-positive individuals first initiating HAART" ppt

Báo cáo y học: "Aboriginal status is a prognostic factor for mortality among antiretroviral naïve HIV-positive individuals first initiating HAART" ppt

Ngày tải lên : 10/08/2014, 05:20
... information on socio-demographic characteristics, there is always a chance for missing information To date several studies dealt with missing information via assumptions about the missing data or ... plasma viral load, age, education, adherence, and history of IDU were associated with HIV plasma viral load response The univariate and multivariate associations of aboriginal status, clinical and ... the HAART era, declines in deaths were smaller among racial minorities (black, Hispanic, Asian/Pacific Islanders, American Indian/Alaskan Native) compared with whites [45] These studies indicate...
  • 9
  • 498
  • 0
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

Ngày tải lên : 12/08/2014, 16:20
... maximum activation of inward current (at -100 mV) by cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i ... visualized on a Zeiss LS 510 confocal microscope (Hertfordshire, UK) Statistical analysis Averaged data are presented as mean ± sem Where appropriate, statistical significance was assessed by unpaired ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism which...
  • 8
  • 341
  • 0
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

Ngày tải lên : 13/08/2014, 01:21
... 5′GTCTCTCTGGTTAGACCAG-3′, Primer C 5′-CTAGTCAAAATTTTTGGCGTACTC-3′ and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG-3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3′ and GAPDH ... http://www.retrovirology.com/content/8/1/61 reading and commenting on the manuscript, and Barbara Felber for sharing several critical reagents We are grateful to Anna Kula and Alessandro Marcello for sharing data in their paper prior ... Nuclear matrins: identification of the major nuclear matrix proteins Proc Natl Acad Sci USA 1991, 88:10312-10316 51 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization...
  • 10
  • 313
  • 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt

Ngày tải lên : 13/08/2014, 13:22
... gleaned from the medical records supported an asthma diagnosis Most patients with asthma are not cared for by asthma specialists and frequently the diagnosis is made on clinical grounds without ... intermittent asthma, each with mild persistent and moderate persistent asthma, and with severe persistent asthma No patient had Page of (page number not for citation purposes) Clinical and Molecular Allergy ... pulmonary infiltrates or arterial hypoxemia The study excluded children with an exacerbation of reactive airways disease If patients with sickle cell disease are at increased risk of airway inflammation...
  • 5
  • 288
  • 0
Báo cáo y học: " Basophil sensitivity through CD63 or CD203c is a functional measure for specific immunotherapy" doc

Báo cáo y học: " Basophil sensitivity through CD63 or CD203c is a functional measure for specific immunotherapy" doc

Ngày tải lên : 13/08/2014, 13:22
... with FACS Lyse (BD Catalog Nr 349202) Data was acquired for minutes from all patients at all visits Each day data was acquired, compensation controls were acquired, and data was compensated before ... the allergen concentration at which half-maximal activation (LC50) is achieved (e) LC50 was normalised to baseline and plotted against visit number Mikkelsen et al Clinical and Molecular Allergy ... salient clinical data for each patient Pt nr Treatment Side effects maintenance dose Ratio CD63 activation at 0,1/1 Traditional traditional fatigue 40000 1,07 weals 100000 1,05 traditional weals...
  • 9
  • 227
  • 0
HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

Ngày tải lên : 09/09/2015, 08:17
... endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant for vascular smooth muscle cells and fibroblasts and induces ... A major obstacle of utilizing NSCs in clinical applications is the need for fetal brain tissue There is limited availability of fetal tissue and it raises multiple moral and ethical complications ... glioma in vitro This experiment serves as an important foundation for further studies The transwell migration assay is a standard approach used for homing studies It is established, easy and convenient...
  • 128
  • 211
  • 0

Xem thêm