13 c nmr spectroscopy as a tool in neurobiology

... searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs a linear combination of the variables to discriminate between the classes ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training ... before, this can be caused either by a real decrease in nucleic acid content or by an increase of the compaction state of DNA possibly related to the cell cycle stage Concerning the latter hypothesis,...

Ngày tải lên: 21/02/2014, 03:20

... is a function that identifies all adjacent features with a certain criteria to a particular feature Contact patterns such as common use of grasslands or sources of purchasing etc could be visualised ... string of such co-ordinates A polygon is a closed line The grid-based format of data is captured as information of each quadratic cell in a screen and could be looked at as a photo of the area ... USA) can be integrated within a GIS Such simulation models can incorporate farm information such as herd size, production type as well as spatial factors like distance to the source of outbreak,...

Ngày tải lên: 12/08/2014, 15:20

... lactis ald gene as follows A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned in ... AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, containing synthetic promoters followed by an ald leader...

Ngày tải lên: 19/02/2014, 17:20

... 6-phosphofructo-1-kinase, which can lead to increased 1 3C labeling at the triose level Such a mechanism can lead to increases in labeling of glycogen C6 even in the presence of decreased activity of the indirect ... which is predominantly a hepatic process Changes in 1 3C- labeled glycogen C1 and C6 concentration (rate of 1 3C label incorporation, D13Glyc1 and D13Glyc6) were calculated by linear regression at ... control mice, the rate of [1-1 3C] glucose incorporation was not significantly increased However, the rate of 1 3C incorporation into the C6 position in glycogen was significantly increased in the ADM...

Ngày tải lên: 17/03/2014, 17:20

... in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of  them are introduced as follows.  3.6.1. Structural measures  A1 : Polyculture   ... pond  area  in the  province. As shown in Fig. 2, the total area of  brackish  water  shrimp  culture  has  increased  approximately 4 times, from 251 ha in 2000 to  902.5  ha  in 2007.  According  ... noted that MCA is subjective in its nature. In case  the  quantitative  data  are  available,  quantitative  analysis  (i.e.  numerical  modelling)  can  be  used  in combination  with  MCA to arrive at the ʺbestʺ solution(s) in the ...

Ngày tải lên: 22/03/2014, 12:20

... practice existentialistic practice unconventional spiritual practice humanistic practice nature-oriented practice R+S+ individuals conventional religious practice existentialistic practice unconventional ... unconventional spiritual practice humanistic practice nature-oriented practice R+S- individuals conventional religious practice existentialistic practice unconventional spiritual practice humanistic practice ... Theoretical Description, Reliability, Exploratory Factor Analysis, and Preliminary Construct Validity Using Health-Related Data Ann Behav Med 2002, 24:22-33 Plante TG, Boccaccini M: The Santa Clara...

Ngày tải lên: 20/06/2014, 15:20

... NIRS analysis is a fast, environment-friendly analytical method that has gained widespread acceptance in recent years It is based on vibrational spectroscopy that monitors changes in molecular ... contain information about all chemical constituents of organic material This advantage eliminates the need to initially pinpoint the key factor that determines a specific characteristic NIRS instruments ... being developed and calibrated to replace classical wet-chemical methods for wood applications In addition, a few studies have used NIRS to assess physical and mechanical properties such as basic...

Ngày tải lên: 08/08/2014, 14:20

... aridity as induced by environmental degradation As a consequence, both C siliqua and Q coccifera can be considered as suitable candidates to natural reforestation of degraded areas of the Mediterranean ... leaves per species each daytime was measured from different trees Leaves were cut off while within plastic bags, placed in zip-lock plastic sacks and kept in a thermal bag at about C At the end ... water relations parameters, because in this month plants were actively growing and water availability was likely high after winter rains Total precipitation during March, April and May 1998 at...

Ngày tải lên: 09/08/2014, 04:20

... decrease in Ca2+ content was shown in the remaining floral organs, except the calyx, which suffered a slight increase in Ca2+ concentration (Figure 2A) For pistil, this decrease was more than 3-fold ... the controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared ... Watts LT, Zheng W, Lechleiter JD: Chemical calcium indicators Methods 2008, 46:143-151 24 Callaham DA, Hepler PK: Measurement of free calcium in plant cells In Cellular Calcium: A Practical Approach...

Ngày tải lên: 11/08/2014, 11:21

... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... carries biological error, this can lead to an increased variation The variation for constructs and 8, i.e., is much larger after normalisation compared to the original data (compare Figs 2A and ... proportionally increase or decrease the outcome of all biological measurements in a session [2] The between-session variation can therefore be modelled as a multiplicative factor working on the data in each...

Ngày tải lên: 13/08/2014, 09:21

... form-function correlations; second, to explain such a characterization in the context of the socioculture as well as the cognitive constraints operating in the relevant area of specialization, ... school curriculum and the broader community‘ Kress (1988) also maintains that genres ―give their users access to certain realms of social action and interaction, and certain realms of social influence ... at least one participant, namely Actor, and three at most, namely Actor, Goal and Beneficiary Actor (such as Susan in Susan is typing) is the ―doer‖ of the action and appears (though not always...

Ngày tải lên: 31/03/2015, 14:14

... form-function correlations; second, to explain such a characterization in the context of the socioculture as well as the cognitive constraints operating in the relevant area of specialization, ... school curriculum and the broader community‘ Kress (1988) also maintains that genres ―give their users access to certain realms of social action and interaction, and certain realms of social influence ... at least one participant, namely Actor, and three at most, namely Actor, Goal and Beneficiary Actor (such as Susan in Susan is typing) is the ―doer‖ of the action and appears (though not always...

Ngày tải lên: 31/03/2015, 14:34

... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... off-flavor described as ‘artificial’ The manufacturer packaged the samples in 150 ml white plastic cups, which were coated with yellow cardboard and sealed with white aluminum lids The packaging was ... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma...

Ngày tải lên: 03/04/2013, 21:06

... Protein kinase Calpha-dependent increase in Ca2+-independent phospholipase A2 in membranes and arachidonic acid liberation in zymosan-stimulated macrophage-like P388D1 cells Biochem Pharmacol ... effector protein, SipA, promotes a lipid signal transduction cascade that recruits an ADP-ribosylation factor guanine nucleotide exchange factor (such as ARNO) to the apical plasma membrane ARNO ... Biol 131 , 1599–1608 McCormick BA, Parkos CA, Colgan SP, Carnes DK & Madara JL (1998) Apical secretion of a pathogen-elicited epithelial chemoattractant activity in response to surface colonization...

Ngày tải lên: 19/02/2014, 02:20

... that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also discuss experiments addressing ... identify exciting new molecules, this approach introduces a Ôblack boxÕ aspect to the use of phage technology In contrast, large scale screens can be very useful when asking certain quantitative questions, ... heavy chain antibody scaffold for use in constructing naı¨ ve antibody libraries [15] Here, the association of the variable heavy chain (VH) with protein A was used as a surrogate for direct...

Ngày tải lên: 19/02/2014, 12:20

... Speci c cell association was calculated as the difference between total and nonspeci c cell association In a parallel set of experiments, the cell association of [3H]CE-HDL3 by choriocarcinoma cells ... Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48] Thus, in most cases, choriocarcinoma has the appearance of ... trophoblast, being predominantly syncytiotrophoblastic or cytotrophoblastic Some cytotrophoblastic choriocarcinomas secrete little human chorionic gonadotropin and some choriocarcinomas also secrete...

Ngày tải lên: 20/02/2014, 23:20

... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases and a C- terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia [31] and reduced plasma PCSK9 [22] As shown ... variants as labeled from the media of transfected and overexpressing Huh7 cells For each variant the change in molecular mass due to the speci c amino acid change is show as DDa (D) A graphic representation...

Ngày tải lên: 16/03/2014, 06:20

... depolymerization by chondroitin ABC endolyase, oligosaccharides are isolated as disaccharides, trisaccharides, tetrasaccharides and, because of incomplete depolymerization, as hexasaccharides (Fig 1) ... 4.2.2.4), whereas chondroitin AC lyases act on CS alone Chondroitin AC and ABC lyases generate disaccharides and tetrasaccharides [4] and have been widely used for the analysis of CS ⁄ DS composition ... endolyase CS#604 and CS#606 are confirmed as containing GalNAc4S-ol and GalNAc6S-ol termini, respectively, through examination of the residue A (galactosaminitol) chemical shifts, which clearly indicate...

Ngày tải lên: 16/03/2014, 14:20

Ngày tải lên: 19/03/2014, 00:20