13 resizing a model in multiple directions

báo cáo hóa học: " Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis" ppt

báo cáo hóa học: " Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis" ppt

... an appropriate therapeutic approach for treating MS and other demyelinating diseases involving neuroinflammation and neurodegeneration Additional material Additional File 1: Figure S1 Confocal ... (Sulzfeld, Germany) and maintained on a 12:12 h light:dark cycle, with standard chow and water freely available Animals were handled according to European legislation (86/609/EEC) and all manipulations ... moderate paraparesis, partial hind limb paralysis, voluntary movements still possible and ataxia; 4, paraplegia and forelimb weakness; 5, tetraparesis; 6, moribund state When clinical signs were intermediate...

Ngày tải lên: 19/06/2014, 22:20

18 422 0
Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf

Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf

... moving speaker tracking Generally, an LS-TDE in a single-frame-based process easily confronts the lack of data problem because the Yang and Kang EURASIP Journal on Advances in Signal Processing ... phase wrapping occurs, If phase wrapping occurs the Gaussian assumption becomes invalid thus a delay estimator which does not include a maximum searching process easily fails Conventional linear ... Received: 31 May 2011 Accepted: 10 January 2012 Published: 10 January 2012 References S Nakamura, K Hiyane, F Asano, Y Kaneda, T Yamada, TN Kobayashi, H Saruwatari, Design and collection of acoustic...

Ngày tải lên: 20/06/2014, 20:20

19 455 0
Báo cáo sinh học: " Detection of multiple QTL with epistatic effects under a mixed inheritance model in an outbred population" pot

Báo cáo sinh học: " Detection of multiple QTL with epistatic effects under a mixed inheritance model in an outbred population" pot

... cases, where the means, medians and modes 424 A Narita, Y Sasaki Table II The true values of the parameters set in respective cases Parametera case l/m case l/m θ a d aa ad da dd case l/m θ a ... the parameters in this article and their meanings are shown in Table I 2.2 Statistical analyses In this study, the Bayesian approach via the Gibbs sampler, the MH algorithm and the RJMCMC algorithm ... comparison, one of the simulated data set in case was analyzed using conventional interval mapping Figure shows that the QTL with the main effect, such as 426 A Narita, Y Sasaki Table III The posterior...

Ngày tải lên: 14/08/2014, 13:22

19 211 0
Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx

Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx

... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT AGTATTCAAAAGACAGCATCAGTGAT ... REB1 AGCGAGAAACAAAGGGATAGAGGAAAAAAATTTTCTCCGTCGGCCGCGGGTGGCAAAAGC AGCGAGGAACCA -GAAAAGAATAAAAAATTTTCTCGGTCGGCCGCGGGTGGCAAAAGC AGCGAGAAACTT GAAAACGGAGAGAAAATTTTCTCCGTCGGCCTCGGGTGGCAAAAAC AGCGAGGAGCCT-GAAAACCACAGAAAATTTTTTCTCCGTCGGCCGCGGGTGGCAAAAGC ... YLR387C_Spar YLR387C_Smik YLR387C_Skud YLR387C_Sbay 1E-11 AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...

Ngày tải lên: 14/08/2014, 14:21

15 288 0
Testing a model of customer-based brand equity in the Vietnamese banking servic

Testing a model of customer-based brand equity in the Vietnamese banking servic

... positive and negative meaning about the brand Aaker illustrates the distinctions between a brand and a product as shown in the figure below Figure 2.2 A brand versus a product BRAND Organizational Associations ... the brand as a product, the brand as an organization, the brand as a person and the band as a symbol) The fifth component is other proprietary brand assets such as patents, trademarks and channel ... between variables Basing on the characteristics of data needed and research purpose, researchers can choose either qualitative or quantitative approach or a combination of these two types Data can...

Ngày tải lên: 06/11/2012, 15:52

81 563 1
Tài liệu Báo cáo khoa học: Synchronization of Ca2+ oscillations: a capacitative (AC) electrical coupling model in neuroepithelium pptx

Tài liệu Báo cáo khoa học: Synchronization of Ca2+ oscillations: a capacitative (AC) electrical coupling model in neuroepithelium pptx

... cytoplasmic domain of cadherin interacts with F-actin via b-catenin and a- catenin; b-catenin binds to cadherin and a- catenin, which in turn interacts with F-actin (Fig 3A) [24] Thus b-catenin plays ... BK channels are activated by a positive voltage change on the luminal side and by an increase in the luminal [Ca2+] [4,7] Because the closing of the store BK channels attenuates Ca2+ release [4], ... cell–cell adhesion may be regulated by the synchronous increases in intracellular [Ca2+], as described below Synchronous increases in intracellular [Ca2+] and disassembly of cadherin–catenin complexes...

Ngày tải lên: 16/02/2014, 09:20

7 641 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

... (primer A and C, not shown) was abundantly present in JAr and Jeg3 cells while only negligible amounts became apparent in BeWo cells In parallel (using primers A and C) a faint 540 bp band (indicative ... cell association and degradation of 125I-labeled Table Specific binding of 125I-labeled HDL to choriocarcinoma cell lines at °C Binding constants were calculated by non linear regression analysis ... island and cell columns, is formed which maintains the ability of proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase...

Ngày tải lên: 20/02/2014, 23:20

12 470 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

... different model on the Lancaster Treebank data set The models used in this evaluation were trained with observation data from the Lancaster Treebank training set The training set and testing set are ... between a standard HMM and a hierarchical HMM is that individual states in the hierarchical model can traverse to a sequence of production states, whereas each state in the standard model corresponds ... task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing...

Ngày tải lên: 08/03/2014, 02:21

8 528 0
Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc

Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc

... valency and thematic role change in causatives To model interactions between domains, we propose a categorial approach in which composition in all domains proceed in parallel As an implementation, ... m a t i o n S t r u c t u r e and Tactical Constraints Entries in the eategorial lexicon have tactical constraints, grammatical and semantic features, and phonological representation Similar ... functions as a basis for grammatical analysis In R T Oehrle, E Bach, and D Wheeler, editors, Categorial Grammars and Natural Language Structures, D Reidel, Dordrecht, 1988 C Pollard and I A Sag 1994...

Ngày tải lên: 08/03/2014, 07:20

3 339 0
Nursing Practice In Multiple Sclerosis: A Core Curriculum doc

Nursing Practice In Multiple Sclerosis: A Core Curriculum doc

... in brain volume Associated Pathology Inflammation Increasing inflammation Edema associated with inflammation Possible demyelination and axonal loss Disruption of blood-brain barrier Changes in ... magnetic resonance imaging (MRI) on a patient with MS In 1984, it became apparent that MRI can visualize MS attacks in the brain, including many that did not manifest symptoms In 1993, FDA approved ... information and energy as they attempt to maintain a balanced state During change, the person of the change agent’s system interacts with the patient’s system to influence change and adaptation A change...

Ngày tải lên: 15/03/2014, 19:20

130 333 0
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

... ethambutol Nat Med 3, 567–570 30 Amemura M, Makino K, Shinagawa H & Nakata A (1990) Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes ... 12 Gopalaswamy R, Narayanan PR & Narayanan S (2004) Cloning, overexpression, and characterization of a serine ⁄ threonine protein kinase pknI from Mycobacterium tuberculosis H37Rv Protein Expr ... phosphoprotein-binding domain Proc Natl Acad Sci USA 96, 7821–7826 32 Chopra P, Singh A, Koul A, Ramachandran S, Drlica K, Tyagi AK & Singh Y (2003) Cytotoxic activity of nucleoside diphosphate kinase secreted...

Ngày tải lên: 16/03/2014, 14:20

11 402 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC ... ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

... over a much wider range of operation than that for which the model was originally intended It has been suggested [17] that inductive, multivariate and machine learning approaches are appropriate ... model for parameter scanning using routines contained in GEPASI METHODS Model A model of branched glycolysis, as described in [7] was obtained in SCAMP format from one of its authors (a kind gift ... equations for adenosine phosphate and triose phosphate species (A5 , A6 , A1 3 A1 5), and in that there is no involvement of the adenosine species in the succinate branch Enzyme kinetics are as described...

Ngày tải lên: 17/03/2014, 11:20

11 530 0
A Model Course for Public Health Education in Chiropractic Colleges: A Users Guide doc

A Model Course for Public Health Education in Chiropractic Colleges: A Users Guide doc

... World Health Organization Department of Health and Human Services (DHHS) a Administration for Children and Families (ACF) b Administration on Aging (AOA) c Agency for Healthcare Research and Quality ... Compare the main features of the Clean Water Act and the Safe Drinking Water act including: Treatment of municipal (point source) discharges Treatment criteria for potable water Acceptable contamination ... have been offered by health organizations, agencies and health educators In 1994 the American Public Health Association (APHA) and the American Medical Association (AMA) established The Medicine/Public...

Ngày tải lên: 22/03/2014, 15:20

76 376 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... viral infections [20] Cancer therapy is a principal goal of the current clinical research on hESCs Recently, regression of metastatic melanoma tumors was achieved by transplantation of adaptive ... engraftment was achieved using both methods as shown by expression of human CD45 3–6 months post-transplantation Additionally, secondary engraftment was achieved following intravenous transplantation...

Ngày tải lên: 22/03/2014, 17:20

12 550 0
Episode 13 A wedding in the air docx

Episode 13 A wedding in the air docx

... Donatella Versace está por llegar de un momento a otro Tiene ideas maravillosas para mi traje para la boda ¡Hasta pronto! Sound of telephone receiver being put down MRS ROMERO Gracias, Antonio ANNIE ... your fantastic life as a single man HECTOR Oh NICK Goodbye to drinking beer and watching football in bed HECTOR Oh NICK Goodbye to eating curry for breakfast Episode 13 A Wedding in the Air HECTOR ... Mamá… Annie y yo MRS ROMERO Mi avión llega a las cinco a Heathrow ¡Hasta pronto! MRS ROMERO Gracias, Antonio Episode 13 A Wedding in the Air 12 HECTOR Oh no!! ANNIE Meet me at Leo’s café at 5pm...

Ngày tải lên: 23/03/2014, 00:20

17 328 0
Towards a Model of Information Aesthetics in Information Visualization pdf

Towards a Model of Information Aesthetics in Information Visualization pdf

... encourage creativity and sharing Dataset Availability The Internet has made the individual creation, collection and sharing of data easier Next to personal content creation, the Freedom of Information ... related to increasing Internet bandwidth have allowed data to become more accessible This availability is not limited to raw datasets as new interfaces have been created that allow interactive access ... expectations may match the designer’s assumptions, so that the data mapping is clear In other cases, the mapping technique may be more arbitrary and determined by context and data Data is thus an inefficient...

Ngày tải lên: 23/03/2014, 13:20

6 264 0
Báo cáo khoa học: "A MODEL OF REVISION IN NATURAL LANGUAGE GENERATION" pptx

Báo cáo khoa học: "A MODEL OF REVISION IN NATURAL LANGUAGE GENERATION" pptx

... text in making its judgements; the original message input to the generator is available as a basis for comparing what was intended with what was actually said The goal is to notice the relationships ... section,we apply this model to the revision of an example summary paragraph The initial generation of a text involves making decisions of various kinds Some are conceptually based, such as what information ... information to include and what perspectives to take Others are grammatically based, such as what grammatical form a concept may take in the particular syntactic context in which it is being realized,...

Ngày tải lên: 24/03/2014, 02:20

7 327 0
w