... psychological harassment.64 The province of Saskatchewan, Canada, followed Québec’s lead three years later, and in 2007 amended their Occupational Health and Safety Act to broaden the definition of harassment ... workplace As we learn more and more about the negative health and safety implications of demand, control, effort and reward, employers The Business Case for a Healthy Workplace © IAPA (Industrial Accident ... the other two also contribute to the financial status and viability of the organization The Business Case for a Healthy Workplace © IAPA (Industrial Accident Prevention Association) 2008 All rights...
Ngày tải lên: 15/03/2014, 20:20
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx
... tax rate, tax loss carryforwards and investment functions – empirical analysis using a large German panel data set Fred Ramb 26 22 2007 Volatile multinationals? Evidence from the labor demand ... Hoffmann Sondergaard, Westelius 34 2007 Factor-MIDAS for now- and forecasting with ragged-edge data: a model comparison for German GDP Massimiliano Marcellino Christian Schumacher 35 2007 Monetary ... quality of banking and regional growth Hasan, Koetter, Wedow 11 2007 Welfare effects of financial integration Fecht, Grüner, Hartmann 12 2007 The marketability of bank assets and managerial Falko...
Ngày tải lên: 22/03/2014, 23:20
Accompanying the document Proposal for a REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on European Social Entrepreneurship Funds doc
... Strategy for jobs and smart, sustainable and inclusive growth Social enterprises can act as drivers of a social change by offering innovative solutions and therefore and therefore make a valuable ... microfinance and not allow the precise identification of social undertakings targeted Alongside these national approaches, there are also industry led pan-European initiatives to create a label for ... businesses are in almost all cases SMEs, the financing patterns in the SME sector as explored in the VC IA also apply to them For SMEs, financing typically varies in nature and balance as enterprises...
Ngày tải lên: 30/03/2014, 12:20
Báo cáo hóa học: " The equiconvergence of the eigenfunction expansion for a singular version of onedimensional Schrodinger operator with explosive factor" pptx
... Department of Mathematics, Faculty of Education, Alexandria University, Alexandria, Egypt 2Faculty of Industrial Education, Helwan University, Cairo, Egypt Authors’ contributions The two authors ... function of the problem (1.6) In the following lemma, we prove an important asymptotic relation for the Green’s function Lemma 2.2 For q(x) Î L1(0, π) and by the help of the asymptotic formulas (2.4), ... The two authors typed read and approved the final manuscript also they contributed to each part of this work equally Competing interests The authors declare that they have no competing interests...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " The equiconvergence of the eigenfunction expansion for a singular version of onedimensional Schrodinger operator with explosive factor" potx
... Department of Mathematics, Faculty of Education, Alexandria University, Alexandria, Egypt 2Faculty of Industrial Education, Helwan University, Cairo, Egypt Authors’ contributions The two authors ... function of the problem (1.6) In the following lemma, we prove an important asymptotic relation for the Green’s function Lemma 2.2 For q(x) Î L1(0, π) and by the help of the asymptotic formulas (2.4), ... The two authors typed read and approved the final manuscript also they contributed to each part of this work equally Competing interests The authors declare that they have no competing interests...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx
... incorporates several constraints on the available silicon area (hardware capacity), B Knerr et al memory (software capacity), and latency as a timing constraint The global criticality/local phase ... values for ρ The metric κ has been calculated for all the sample graphs, and the performance of GA, TS, and RRES has been plotted against this characteristic value, as shown in Figure 11 The Ω values ... rank levels are annotated at the bottom of the graphic The fundamental idea of the algorithm explained in Section is that, in general, a local optimal solution, for instance, covering the rank...
Ngày tải lên: 22/06/2014, 06:20
The Easiest Way for a Beginner to Score a Blockbuster Joint Venture By Jason Fladlien pptx
... no matter how much money you pay no matter what The reason is that these joint venture partners already are successful and it's not the money that woos them, it's other factors So right away, ... choose to respond to the email or ignore it and feel bad for being mean They have to read the email, consider it, and then reply It's a time waster to them in out of 10 cases No matter how good your ... change the approach of your joint venture proposal, so you're not a pest or nuisance The easiest way is to engage this philosophy: no matter what, you at least need to bring a smile to their face...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo nghiên cứu khoa học: "USING ADAPTIVE CONTROL TO SOLVE THE TRACKING PROBLEM FOR A MOBILE MANIPULATOR" pptx
... perform the welding task, an assignment for the mobile platform and the manipulator is made as: the mobile platform should track the curved surface in which the welding trajectory lies on, and the ... the proposed controller The paper also shows how to get the tracking errors by the potentiometer and the camera sensor The experiments are performed for getting the practical information A camera ... and the manipulator has the duty of reaching to the altitude of the welding point 2.2 Kinematic Modeling for the Mobile Platform The kinematic equation of the platform can be described as the following:...
Ngày tải lên: 22/07/2014, 02:20
Báo cáo toán học: "A new determinant expression of the zeta function for a hypergraph" ppt
... graphs, and showed that the reciprocals of zeta functions of regular graphs are explicit polynomials A zeta function of a regular graph G associated with a unitary representation of the fundamental ... fundamental group of G was developed by Sunada [11,12] Hashimoto [4] treated multivariable zeta functions of bipartite graphs Bass [2] generalized Ihara’s result on the zeta function of a regular graph ... identity by using a linear algebraic method Stark and Terras [9] gave an elementary proof of this formula, and discussed three different zeta functions of any graph Various proofs of Bass’ Theorem were...
Ngày tải lên: 08/08/2014, 01:20
Analyzing the markets opportunity for a new product the case of thread deformed bar steel of vina kyoel steel company
... reduce the need Want Kotler (1997) also defined Human wants are the form taken by human needs as they are shaped by culture and individual personality A hungry person in Bahrain may want a vegetable ... supply and demand chains and available markets for many different companies as well 8.2 Economic: A market boom, recession, or growing inflation problem can all change the way an organization plans ... fields Capacity Utilization: Governments and private industry alike in all parts of Canada have recognized additional opportunities for other regions of Canada to increase their participation in the...
Ngày tải lên: 22/10/2015, 13:23
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot
... plasmid To facilitate cloning, a BamHI site was introduced by sitedirected mutagenesis at position 5979, upstream the env initiation codon, using the primer 5'-TGCAAATAAATGGATCCAACAAGTAGCAAAAGT-3' ... 6000) Mutagenic primers 5'-GGGACAGCAAGCTAAGTATCAA3' (nt 6113 to 6134) and 5'-TATCAACCCCAGCTAAGTAAGCAA-3' (nt 6129 to 6152) were used to disrupt the SD6123 and SD6140 sites, respectively The resulting ... amplify cDNAs from infected GSM cells were Mar52 (5'-TAATCTGTGCAATACCAGAGCGGCT-3'; nt 131 to 155; forward primer) and M3b Primer pair MarN (5'-CAGCAAGGTAAGTATCAACCCCAG-3'; nt 6117 to 6140; forward primer)...
Ngày tải lên: 13/08/2014, 06:20
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... and the relevant mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic ... mixture with E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were ... chymotrypsin) and Arg282 (for trypsin) of the E 1a subunit, two conserved residues in a loop at the entrance to the active site (Fig 1), as the main cleavage sites Cleavage of the E 1a- subunit activated the...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx
... forming the GC domain, by a Bpu1102I ⁄ KpnI co-digestion A synthetic linker (complementary oligonucleotides 5¢-TGAGCAACTCAAGAGA GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C-3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT ... in the membrane preparation, as measured using a gamma counter Membrane preparations were then used in guanylyl cyclase assays A total of lg of membranes was incubated for 12 at 37 °C in the ... other than NPR -A are also modulated by ATP Recently, Yamazaki et al found that retinal GC can be activated by guanylyl cyclase activating proteins (GCAPs) to at least 10–13-fold over control activity...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: "Natural black pine (Pinus nigra subsp salzmannii) forests of the Iberian eastern mountains: development of the phytoecological basis for their site evaluation *" pptx
... xerothermic sites (ranging between 900 to 100 m) Some typical species of the bushy formations of the area, Thymus vulgaris, Lavandula latifolia and Koeleria vallesiana, appear as nonindicative of the ... phoenicea, Salvia lavandulifolia, Satureja intricata and Erinacea anthyllis can be found The almost complete absence of nemoral species in the understory and the frequent appearance of Quercus ... subMediterranean species, while species of the bushy formations are more frequently found Among indicator and preferential species are Astragalus granatensis, Avenula pratensis, Festuca rubra, Scabiosa...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa học: "Port site metastasis following diagnostic laparoscopy for a malignant Gastro-intestinal stromal tumour" pot
... surgery, was the consultant in charge of the patients' care and made alterations to the final draft of the paper Figure Port site metastasis Port site metastasis Uptake can be clearly seen in the Abdominal ... theory protecting the specimen from contacting the layers of the abdominal wall), although the port itself then required removal The advanced nature of the tumour also increased the risk of a ... stromal tumours are the most common mesenchymal tumour affecting the GI tract They may present in a variety of ways, can range from small to very large and demonstrate a great diversity in their...
Ngày tải lên: 09/08/2014, 07:21
báo cáo khoa học: "Failure of functional imaging with gallium-68DOTA-D-Phe1-Tyr3-octreotide positron emission tomography to localize the site of ectopic adrenocorticotropic hormone secretion: a case report" ppsx
... Victoria, Australia Authors’ contributions EG, AC and RM analyzed and interpreted the patient’s data and were involved in the patient’s care LG was a major contributor to writing the manuscript All ... the Austin Hospital’s thoracic surgical unit and its radiology department for their assistance in the management of this patient Author details Endocrine Centre and Department of Medicine, Austin ... lethargy, amenorrhea and marked anxiety An examination revealed features of Cushing’s syndrome with rounded face, buffalo hump, abdominal striae and proximal muscle weakness Investigations confirmed...
Ngày tải lên: 10/08/2014, 23:20
Write a report for a university lecturer describing the information in the graph below
Ngày tải lên: 04/10/2012, 10:02
Write a report for a university lecturer describing the information in the graphs below
... model answer: The graphs compare the number of deaths caused by six diseases in Someland in 1990 with the amount of research funding allocated to each of those diseases It can be clearly seen that ... deaths from leprosy, 0.3 million deaths from tropical diseases, 0.5 million deaths from diarrhoea, 0.4 million deaths from malaria and 1.8 million deaths from TB These figures can be contrasted ... dollars in research funding, diarrhoea 60 million dollars in research funding, malaria 50 million dollars and TB 20 million dollars in research funding In conclusion it is clear that funding allocation...
Ngày tải lên: 04/10/2012, 10:02