Ngày tải lên: 09/05/2016, 08:53
... change Interest inventories are great for the first day of class An interest inventory is just a short list of questions about students' backgrounds and interests It may assess their prior learning ... write a short paragraph or answer specific questions Finally open-ended questions are useful: o What are your goals after graduation? o What has a teacher done in the past that helped you to learn ... Every good class has an introduction, a body, and a conclusion I usually teach the mini-lesson, and then save the last six to eight minutes of class for the interest inventory and individual questions...
Ngày tải lên: 10/07/2014, 21:00
PHP The First Day potx
... Server Suites: LAMPP,XAMPP, EasyPHP Integrated Development Environment – NetBean, Eclipse, Dreamweaver Database – MySQL Administrator Tool – MySQL Query Browser (ti p) XAMPP – Download t website: ... ñư c ch y client • Applet • Flash – ð ng ph a Server: • Common Gateway Interface (CGI) • Java Server Pages (JSP) • ASP: Microsoft – Vi t b ng VBScript, JavaScript ch y ph a server – S d ng web ... website: http://www.apachefriends.org/en/xampplinux.html – Cài ñ t XAMPP: vào Terminal, gõ: tar xvfz xampp-linux-1.6.7.tar.gz -C /opt – Kh i ñ ng XAMPP: vào /opt/lampp/lampp start Terminal, gõ: – Chú...
Ngày tải lên: 13/07/2014, 18:20
The first day i went to school, hãy nói về ngày đầu tiên đi học của bạn
Ngày tải lên: 24/08/2015, 11:50
23965 the first day in a nonsegregated school
... and what………… Can we do? This may mean the student should have appropriate place to study,………………….meals and all the support he needs 2) put the words in parentheses in the correct form or tense ... from the age of about three, but these schools are not………… however at the age of five all children…………….go to primary school Primary education lasts six years Then pupils go to secondary school After ... be themselves They are forced to sit in a chair for a certain amount of time and to (quiet) ……………….complete assignments The thought of this repeated activity results in students caring less about...
Ngày tải lên: 26/08/2016, 15:32
The First and Last
... snatches the evening paper from his armchair, and runs it over anal reads] Here it is again "Body of a man was found this morning under an archway in Glove Lane From marks about the throat grave ... with a worn, high cheek-boned face, deep-sunk blue eyes and wavy hair all ruffled a face which still has a certain beauty He moves inwards along the wall, stands still again and utters a gasping ... eyebrows The curtained door away out in the dim part of the room behind him is opened so softly that he does not wake LARRY DARRANT enters and stands half lost in the curtain over the door A thin...
Ngày tải lên: 06/11/2012, 14:13
First Name, Last Name or Title?
... • Frank Olaf was promoted to department head last week (Tuần trước Frank Olaf đề bạt lên trưởng phòng) • Isn't that Susan Hart over there? (Susan Hart à?) Trên số quy tắc xưng hô tên gọi giao ... completed the report on time (Jones không hoàn thành báo cáo hạn) • Ask Anderson to come into the office as soon as he gets in (Bảo Anderson vào văn phòng đến) Gọi tên đầy đủ (First and last name) ... Jolie and Pitt came to Vietnam last year (Angelina Jolie Brad Pitt đến thăm Việt Nam hồi năm ngoái) Thông thường, cấp tức giận không hài lòng, họ gọi cấp theo cách này: Ví dụ: • Jones hasn't...
Ngày tải lên: 03/09/2013, 14:10
A study on teaching oral skills to the first year students at Hanoi University of Industry in the Communicative Approach
... limitations are fully acknowledged and reflect the fact that this data was originally gathered for a dissertation on an MA in Teaching English as a Foreign Language, by the author of this paper ... Teachers at HaUI If students are the most important factor in the learning process, teachers are the most important factor in the teaching process At HaUI, there are more than 100 teachers of ... intertwine the organizational aspects of language with the pragmatic • Language techniques are designed to engage learners in the pragmatic, authentic, functional use of language for meaningful...
Ngày tải lên: 07/11/2012, 15:01
The Citizen-Soldier or, Memoirs of a Volunteer potx
... or the day after, if they not leave, a battle will take place Our men appear eager for the fray, and I pray they may be as successful in the fight as they are anxious for one 29 It is half-past ... guard-mounting, half-past five; first call for dress-parade, six; second call, half-past six; tattoo at nine, and taps at half-past So the day goes round Hardee for a month or more was a book of ... despair 14 Every day we have the roar of artillery, the rattle of musketry, the prancing of impatient steeds, the marching and countermarching of battalions, the roll of the drum, the clash and...
Ngày tải lên: 17/03/2014, 02:20
summary and commentary on the first three scenes in act iii of macbeth
... convinced Macbeth to murder Duncan, Macbeth here convinces the murderers against Banquo The last speech of Macbeth is in a way similar to the one of Lady Macbeth addressing the evil spirits Lady Macbeth ... could have sent an extra murderer Banquo is killed in the murderers' ambush but Fleance makes an escape The murderers make their way back to report to the King Here again, the atmosphere plays an ... harm him When Lady Macbeth tells him to wear a bright and jovial face for the banquet, Macbeth agrees, adding that while the crown is unsafe, they should keep their titles honourable and let their...
Ngày tải lên: 21/03/2014, 22:51
History of Cuba; or, Notes of a Traveller in the Tropics pdf
... fine large harbors; those of Havana, Niepe and Nuevitas, are among the best The bay of Matanzas is also capacious; Cardenas and the roadstead of Sagua la Grande have plenty of water for brigs and ... Bayamo, CHAPTER I 22 Camaguey, Jagua, Cueyba, Habana and Haniguanica At the head of each was a governor, or king, of whose laws we have no record, or even tradition An unbroken peace reigned among ... Decadence of Spanish power History of Cuba The rovers of the Gulf Havana fortified The tyrant Velasquez Office of captain-general Loyalty of the Cubans Power of the captain-general Cupidity of the...
Ngày tải lên: 24/03/2014, 03:21
The financial reporting framework may not provide specific guidance for inclusion or exclusion of a docx
... auditing and assurance standards and by facilitating the convergence of international and national standards, thereby enhancing the quality and uniformity of practice throughout the world and strengthening ... in the private sector, or materiality for components may also be assessed at a low level This may occur for a variety of reasons, including the context of the matter, or the nature and characteristics ... Example of Basis for Qualified Opinion and Report on other legal and regulatory requirement for use in the public sector Appendix of ISA 600 contains an example of an auditor’s report containing a...
Ngày tải lên: 19/06/2014, 21:20
Depression and stress among the first year medical students in university of medicine and pharmacy at hochiminh city, vietnam
... chronic, and as external or internal to the organism The Diagnostic and Statistical Manual of Mental Disorders (DAM-IV-TR) defines a psychosocial stressor as "any life event or life change that may ... Anxiety The Diagnostic and Statistical Manual of Mental Disorders (DSM-IV) defined anxiety as "apprehensive anticipation of future danger of misfortune accompanied by a feeling of dysphoria or ... sample database was checked by double entry For data analysis, the Statistical Package for the Social Sciences (SPSS version 13) was used The analysis part composed parts, descriptive and analytical...
Ngày tải lên: 23/07/2014, 03:36
USING PORTFOLIOS IN TEACHING LISTENING SKILL TO THE FIRST YEAR NON ENGLISH MAJOR STUDENTS OF ACCOUNTING DEPARTMENT ACADEMY OF FINANCE
... people gain a large portion of their education, their information, their understanding of the world and of human affairs, their ideals, sense of values, and their appreciation In this day of mass ... about the suitable portfolio contents Under the light of the analysis of the present data, it is clear that the subjects of this study are aware of the advantages and benefits of portfolio assessment ... method, the Direct method, the Audio-lingual method, and the Communicative approach It is very important that most of them are very aware of the importance of the Communicative approach when working...
Ngày tải lên: 19/03/2015, 10:33
Problems faced by the first-year students at Thanhhoa College of Culture and Arts in developing vocabulary for speaking in different subject areas
... they soon forget most of them There may be problems in their ways of learning vocabulary and problems in teaching it All of the above reasons have inspired the author to carry out a research on ... limited to the area of learning vocabulary in the current learning materials for the first year students at THCCA This minor thesis deals with the common problems which students have met, and basing ... that utilizes both quantitative and qualitative approaches The quantitative analysis is employed through the process of data collected from written questionnaires and the qualitative approach...
Ngày tải lên: 04/08/2015, 09:40
Student’s attitudes towards the integrated approach to grammar teaching, a quasi-experimental research on the first year students at hanoi college of economics andtechnology
... wellknown linguists, the author has an idea that many of the approaches to grammar teaching, currently popular or has been waned, all have the advantages and availability and suitability to be utilized ... language learning 1.2 Theoretical background of grammar teaching 1.2.1 Definitions of grammar and the place of grammar in English language teaching 1.2.2 The brief view of grammar teaching approaches ... on a case with a target on the first year non-English-major students at Hanetco, this research examined the learning of grammar before and after the experiment of the integration of approaches...
Ngày tải lên: 04/08/2015, 09:40
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... the alkaline protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis ... on thiamin degradation Other enzymes involved in the thiamin pathway A comparative analysis of the thiamin biosynthetic pathway of more than 80 bacterial genomes was performed [4] The H pylori...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf
... or more minor conformations for the R4 peptide, as evidenced by the appearance of additional resonances of lower intensity than those in the major conformer [21] However, only one major conformation ... rate of filament formation was much greater for R4 than for pR4, indicating non-identical filament formation for the R4 and pR4 peptides Electron microscopy was also used to evaluate the aggregation ... shifts and negative values are upfield shifts NH and 0.10 p.p.m for aH) In general, the chemical shift of NH deviates was more than that of aH upon phosphorylation Notable chemical shift deviation of...
Ngày tải lên: 16/03/2014, 05:20