12  access the parent of a flex component

... the proposed aggregate and coating at their proposed rate of application prior to publication of a specification will enable the designer to anticipate the appearance and texture of the surface ... rate of aggregate application is suitable for the aggregate gradation specified in Article 2.2.2.1 and coating rate of application specified in Article 2.3.4.1 If either of these is changed the ... in Article 2.3.4.2 If either of these is changed the coating application rate may have to be adjusted A sample should be prepared to evaluate the resulting surface, 2.3.4.2 Aggregate application...

Ngày tải lên: 24/10/2014, 22:12

... graph Then the theorem states that a. a.s a linear-sized ‘giant component emerges quite precisely at the point where the average degree in the graph is In the past decades, much research has ... Bohman, A Frieze, and N Wormald Avoidance of a giant component in half the edge set of a random graph Random Structures Algorithms, 25(4):432–449, 2004 [5] T Bohman and J H Kim A phase transition ... that for any c > 1.5, a random 3-vertex-coloring of Gn,cn yields a giant component a. a.s On the other hand, Achlioptas and Molloy [1] showed that a. a.s Gn,cn can be properly 3-colored as long as...

Ngày tải lên: 08/08/2014, 12:22

... CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC Trk1-Seq-F1 ACAAAGACAGCACCAACAGA Trk1-Seq-R1 GAAGTAGTGAACCGCGATAA Trk1-Seq-F2 TGGATCGTGCAATTATCTTG Trk1-Seq-R2 AAGGCGATTAAGTTGGGTAA ... potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in DNA manipulation, available ... channels and are strongly regulated by voltage They are active at the plasma membrane as inward, weakly-inward and outward channels The KCO family does not have voltage sensor domains as in Shaker family,...

Ngày tải lên: 16/10/2015, 11:57

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... that must be prevented For example, a data manager may wish to temporarily allow read-only access to cached data The locking on a page may later be changed as deemed necessary by the data manager ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data...

Ngày tải lên: 12/09/2012, 15:05

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...

Ngày tải lên: 21/09/2012, 10:39

... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...

Ngày tải lên: 02/10/2012, 12:07

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...

Ngày tải lên: 25/10/2012, 11:00

... engages mainly in the industry of household appliances, as well as the domains of real estate and logistics The group is also one of the largest manufacturing and exportation bases of electric appliances ... Generally, if possible, it is wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade ... days after of the buyer’s advice ARTICLE 8: ARBITRATION During the performance of the contract, if any dispute arises, the parties shall discuss to find solution in an amicable way If the parties...

Ngày tải lên: 18/04/2013, 08:57

... water ascends to the top of the tank It is originated from the fact that, after gaining heat from the solar radiation, the tank wall heats a thin vertical layer of water along the tank wall Part ... function of the density, specific heat capacity and the initial and massweighted average temperatures of water; with all the values, apart from the mass-weighted average temperature, are the same ... solar radiation and average temperature of the present experimental study and the theoretical results of [1] in January Figure 12 The time variation of solar radiation and stored energy of the...

Ngày tải lên: 05/09/2013, 15:28

... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...

Ngày tải lên: 06/09/2013, 05:48

... the great masses of humanity are using the Law destructively, or partially so, and the scales are balanced against them Here and there, among the masses, we find an occasional outstanding figure ... inferior creatures as the beasts of the field, the birds of the air and the fish of the sea are bountifully supplied For any man, no matter what his station in life, to take the stand that it is the ... we know what we are talking about when we speak of the chaos of thoughts in the air http://www.RetrieveALover.com Page 33 The Message of a Master On the other hand, the man who has a set definite...

Ngày tải lên: 15/12/2013, 06:15

... and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, in the book The Experience Economy (1999), authors ... mirrors the myriads of interactions taking place in a company and the value created in each of them The problem is not the amount of relationships since firms have the help of sophisticated information ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar...

Ngày tải lên: 20/12/2013, 17:15

... is the TAB character rowDelimiter The character or characters that separate rows The default value is the CARRIAGE RETURN character nullExpr A string that is substituted for null column values ... If a number larger than the number of records in the table is specified, all records are converted without error columnDelimiter The character or characters that separate columns The default value ... corresponding to the rows selected from the table dt The DataTable to convert to a string numRows The number of rows in the table to convert If this number is negative, all rows in the table are converted...

Ngày tải lên: 24/12/2013, 05:15