11 7 using the multiple regression model for prediction

Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

... cases, these include a fixed regression of the same form as the random regression (e.g (9, 11, 12!), which can be thought of as modelling the population trajectory, while the random regressions for ... be formulated for the sources of variation modelled by random regression coefficients in any RR model Regression models, fixed or random, require some assumptions about the parametric form of the ... L.R., Estimates of genetic parameters for a test day model with random regressions for production of first lactation Holsteins, J Dairy Sci 80, 19 97) 76 2 -77 0 [11] Jamrozik J., Schaeffer L.R., Dekkers...

Ngày tải lên: 09/08/2014, 18:21

20 217 0
systems with hysteresis. analysis_ identification and control using the bouc–wen model

systems with hysteresis. analysis_ identification and control using the bouc–wen model

... Summary of the Obtained Results 4.6 The Four Regions of the Bouc–Wen Model 4.6.1 The Linear Region Rl 63 63 64 64 67 69 69 71 74 77 79 79 81 82 84 85 87 89 94 94 96 97 CONTENTS 4.6.2 The Plastic ... 4.6.3 The Transition Regions Rt and Rs 4 .7 Interpretation of the Normalized Bouc–Wen Model Parameters 4 .7. 1 The Parameters and 4 .7. 2 The Parameter 4 .7. 3 The Parameter n 4.8 Conclusion ix 105 1 07 ... to the memory nature of inelastic behaviour where the restoring force depends not only on the instantaneous deformation but also on the history of the deformation The detailed modelling of these...

Ngày tải lên: 12/12/2013, 22:41

223 525 1
LISTENING DIFFICULTIES PERCEIVED BY TEACHERS AND STUDENTS IN USING THE NEW ENGLISH TEXTBOOK FOR GRADE 10 AT QUE VO II UPPER SECONDARY SCHOOL IN BAC NINH

LISTENING DIFFICULTIES PERCEIVED BY TEACHERS AND STUDENTS IN USING THE NEW ENGLISH TEXTBOOK FOR GRADE 10 AT QUE VO II UPPER SECONDARY SCHOOL IN BAC NINH

... of the text as they can recall, they generally 17 remember some bits of the text and forget others By and large, they can not fulfill the tasks if they focus on linguistic items rather than the ... This helps them take the information or whatever they have produced in the previous stage, and other meaningful activities There are two common forms that post-listening tasks can take They are ... opinions They like listening to and the tasks in textbook 78 % 11% 11% They like listening to songs, game or free activities 33% 56% 11% (without doing tasks) They are afraid of listening because they...

Ngày tải lên: 05/02/2014, 22:02

53 1,2K 7
Tài liệu Evolving the neural network model for forecasting air pollution time series pdf

Tài liệu Evolving the neural network model for forecasting air pollution time series pdf

... Intelligence 17 (2004) 159–1 67 165 Table The validation results of the optimised models (1–10) and the reference model when testing models multiple times The minimum and maximum indices are in bold Model ... (Section 2.5) was used for evolving the MLP for the forecasting problem (Fig 3) The starting populations were initialised with the random set of MLP models (see the encoding in the Section 2.4) and ... is presented for each model and the reference models in Table and the scatter plots (forecasted versus observed) in Fig Compared to the reference model, a slight increase in the performances was...

Ngày tải lên: 17/02/2014, 22:20

9 529 1
Tài liệu The Dynamic Retention Model for Air Force Officers- New Estimates and Policy Simulations of the Aviator Continuation Pay Program doc

Tài liệu The Dynamic Retention Model for Air Force Officers- New Estimates and Policy Simulations of the Aviator Continuation Pay Program doc

... describes the characteristics and logic of the DRM Chapter Three compares the DRM with the ACOL model, and Chapter Four presents the modeling results Appendix A gives the estimates produced by the model, ... advance to either the officer or the analyst The shock affects the value the individual places on staying in the military until the next decision The shock can make an individual place either a higher ... of the model The ACOL model devised by John Warner and others provides many of the benefits of the DRM with considerably less computational burden So, before proceeding further in discussing the...

Ngày tải lên: 17/02/2014, 23:20

85 468 0
Báo cáo khoa học: "Improving the Performance of the Random Walk Model for Answering Complex Questions" pptx

Báo cáo khoa học: "Improving the Performance of the Random Walk Model for Answering Complex Questions" pptx

... as the sum of its relevance to the question (i.e rel(s|q)) and the similarity to other sentences in the collection (i.e sim(s, v)) The denominators in both terms are for normalization C is the ... sentences using both the syntactic and shallow semantic trees and their associated kernels For each sentence it measures the syntactic and semantic similarity with the query and takes the average of these ... straight forward Given a sentence (or query), we first parse it into a syntactic tree using a syntactic parser (i.e Charniak parser) and then we calculate the similarity between the two trees using the...

Ngày tải lên: 23/03/2014, 17:20

4 456 0
Apress beginning iOS 5 games development, using the iOS 5 SDK for ipad iphone and ipod touch (2011)

Apress beginning iOS 5 games development, using the iOS 5 SDK for ipad iphone and ipod touch (2011)

... navigate from one view to the other The first step is to add the buttons, and then to configure the navigation Figure 1 7 shows these views being wired up for navigation Figure 1 7 Storyboard with navigation ... In Figure 1 7, we see that we have dragged a UIButton from the library item A onto each of the views We gave the UIButton on the left the label Play, and the UIButton on the right the label Back ... want I selected Model We can repeat the process for the Back button: right-drag it to the view on the left and select which transition you want for the return trip You can run the application...

Ngày tải lên: 24/04/2014, 10:13

341 364 0
Data Modeling Using the Entity - Relationship Model

Data Modeling Using the Entity - Relationship Model

... that are represented in the database For example the EMPLOYEE John Smith, the Research DEPARTMENT, the ProductX PROJECT – Attributes are properties used to describe an entity For example an EMPLOYEE ... For example, the EMPLOYEE entity type or the PROJECT entity type  An attribute of an entity type for which each entity must have a unique value is called a key attribute of the entity type For ... Simple – Each entity has a single atomic value for the attribute For example, SSN or Sex  Composite – The attribute may be composed of several components For example, Address (Apt#, House#, Street,...

Ngày tải lên: 12/05/2014, 11:55

37 611 0
Three essays on real estate, environmental, and urban economics using the hedonic price model technique

Three essays on real estate, environmental, and urban economics using the hedonic price model technique

... Dev 70 5, 673 .42 3,815.81 529 6,144.42 4,438.52 341 7, 793.15 9,609 .75 372 7, 596.39 11, 836 .77 56 6,623 .75 2,901 .74 N Predicted rent no REA (b) Mean Std Dev 4,224.08 2,926.85 5, 277 .79 3, 878 .41 7, 190.4 ... NEARFREEWAY 29.10 23.15 44. 27 41.54 13.32 17. 54 36 .73 19.39 PROXRR 17. 98 17. 56 44.66 0.40 5.53 1 .75 28. 57 17. 35 3.60 4.34 4.64 4. 67 10.43 8.56 41.00 4.66 124. 27 1 07. 68 72 .23 74 .36 52 .75 53.68 59.14 41.00 ... 6,536 .11 2,5 07. 19 Predicted rent no REA (b) Mean Std Dev 10,954.24 2524.66 9,514.64 4, 377 .44 9,242.88 4, 675 .72 11, 181.62 7, 271 .13 7, 196 .7 2,865.42 % (a) - (b) Mean 11. 3 -4.81 -7. 01 -6.29 -7. 94...

Ngày tải lên: 03/06/2014, 02:21

148 606 0
báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

... Orientation Primer Sequence Amplicon Size Melt Temp GAPDH FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC FOR RC GTGACTTCAACAGTGACACC CCTTGGAGGCCATGTAGACC ATCGAAGGGGACTTCCGCTG ...

Ngày tải lên: 20/06/2014, 00:20

12 522 0
Báo cáo khoa hoc:"Genetic parameters of a random regression model for daily feed intake of performance tested French Landrace and Large White growing pigs" pptx

Báo cáo khoa hoc:"Genetic parameters of a random regression model for daily feed intake of performance tested French Landrace and Large White growing pigs" pptx

... , γ 275 140 2 67 199 2 07 10 380 656 568 414 523 683 58 5 07 3 47 366 370 850 162 76 4 71 5 10 598 10 954 636 17 138 558 235 24 512 (3,2) (3,3) depend on the amount of information available in the data ... of the chains to identical sample values For the other three chains of model and the four chains of model the same burn-in period was adopted and checked graphically on the single chains only The ... tested animals) Week Day 11 18 25 32 39 46 53 60 10 67 11 74 12 13 81 88 LW % 312 263 229 173 292 255 213 1 37 9 07 2 27 509 131 14 95 .7 93.6 92.2 89.9 94.8 93.3 91.6 88.4 78 .9 50.8 21.1 5.4 0.6 FL...

Ngày tải lên: 09/08/2014, 18:21

24 292 0
Báo cáo y học: " Advantages of the single delay model for the assessment of insulin sensitivity from the intravenous glucose tolerance test" doc

Báo cáo y học: " Advantages of the single delay model for the assessment of insulin sensitivity from the intravenous glucose tolerance test" doc

... significant for 1/HOMA-IR, HOMA2 and for KxgI both in the whole sample (P < 0.001 for the KxgI, P = 0.002 for the 1/HOMA-IR and P = 0.001 for the HOMA2) and in the reduced sub-sample (P < 0.001 for the ... concentrations as the true forcing function for glucose kinetics Figures and show the performance of the two models in terms of their ability to describe the observed data The apparent better fit of the Minimal ... 96.4 Std Dev 9 .7 8.4 16.2 6 .7 0.4 59 .7 Std Err 2.9 2.5 4.9 2.0 0.1 18.0 N 11 11 11 11 11 11 Mean 45.5 164 .7 83.4 30.9 4.5 57. 3 Std Dev 16.2 8.6 24.3 9.3 0.5 42 .7 Std Err 1.9 1.0 2.8 1.1 0.1 5.0...

Ngày tải lên: 13/08/2014, 16:20

20 284 0
Báo cáo sinh học: " Bayesian estimation in animal breeding using the Dirichlet process prior for correlated random effects" docx

Báo cáo sinh học: " Bayesian estimation in animal breeding using the Dirichlet process prior for correlated random effects" docx

... intervals for the variance components and h Parameter Traditional Bayes h2 17. 87 ; 19 .70 0.26 ; 1.16 0.06 ; 0.22 Nonparametric Bayes Dirichlet process prior 17. 77 ; 19 .71 0.29 ; 1.69 0. 07 ; 0.33 The ... 18.83 17. 28 ; 20.26 2.09 1 .74 ; 2.42 7. 21 6.59 ; 8.01 1.99 1.39 ; 2 .76 0.03 0.68 ; 0 .71 1 .72 1.01 ; 2.45 2.28 1.60 ; 2.95 2.03 1.29 ; 2 .79 0.91 0.20 ; 1.69 7. 23 5.81 ; 8 .70 from the rankings of the ... well as the 95% credibility intervals were calculated using the Gibbs sampler As expected the estimates of the xed effects for the different methods are for all practical purposes the same The Dirichlet...

Ngày tải lên: 14/08/2014, 13:21

22 248 0
proposing the leadership buiding model for fpt

proposing the leadership buiding model for fpt

... thesis, the writer would like to propose the Leadership Building Model for FPT Corporation, the company in the strong need of leaders to prepare for the development in the coming years The reason for ... evaluate the assignment’s result based on the plan for personal development by the mentee Internal Assessor Participating in the evaluation before and after the training Giving requirements for the model ... Leadership Building Model applied for the case of FPT We will see what is the model, how it operates in order to help FPT solve the problem of FPT in lacking leaders in the future within the thesis with...

Ngày tải lên: 14/10/2014, 01:13

63 258 4
using the border gateway protocol for interdomain routing

using the border gateway protocol for interdomain routing

... and the IP address is usually the IP address of the interface at the other end of the connection (For the exception to this rule, see the section "EBGP Multihop," later in this chapter.) For ... Incomplete) If the origin codes are the same, prefer the path with the lowest MED attribute If the paths have the same MED, prefer the external path over the internal path If the paths are still the same, ... When there are multiple paths to the same destination, the local preference attribute indicates the preferred path The path with the higher preference is preferred (the default value of the local...

Ngày tải lên: 16/11/2014, 19:49

63 274 0
w