11 3 quản lý thiết bị hiển thị các thiết bị được liệt kê theo loại
Báo cáo y học: "Analysis of bacterial DNA in synovial tissue of Tunisian patients with reactive and undifferentiated arthritis by broad-range PCR, cloning and sequencing" pps
Ngày tải lên :
09/08/2014, 10:23
... AP009048 1 ,38 9 99.71 Escherichia sp (2 ReA) DQ 337 5 03 1 ,39 0 99.71 Klebsiella sp (1 UA) U32868 1 ,38 7 99.57 Neisseria flava (1 UA) AJ 239 301 1 ,33 8 98. 43 Paracoccus sp (1 UA) AY745 834 1 ,30 8 99.92 Propionibacterium ... OA) AF 439 314 1 ,37 8 99.71 Acinetobacter sp (2 ReA + RA) Z 934 42 1 ,36 5 99 .35 Alcaligenes faecalis (2 ReA+ UA+ RA+ OA) AY54 838 4 1 ,38 5 99. 93 Escherichia coli (3 ReA+ UA+ RA+ OA) V0 034 8 1 ,39 3 100.00 ... 1 ,33 3 99.17 Halomonas sp (1 UA) AJ302088 1 ,38 9 98.85 Leucobacter luti (1 ReA) AM072819 1 ,36 9 98 .39 Novosphingobium sp (1 UA) AB1778 83 1 ,33 5 97.00 Pedomicrobium australicum (1 UA) X976 93 1 ,32 4...
- 14
- 500
- 0
Báo cáo khoa học: Spermosin, a trypsin-like protease from ascidian sperm cDNA cloning, protein structures and functional analysis doc
Ngày tải lên :
17/03/2014, 11:20
... - (kDa) 29 1.9 kb 28 kDa: IVGG 33 kDa: IVGG SEGP 40 kDa: IVGG SEST 40 33 28 C Signal peptide Light chain Heavy chain Preprospermosin H 23 97 130 D S 178 230 32 4 38 8 Cleavage site SEST Spermosin ... a heavy chain (residues 130 38 8) and a light chain designated as L1 (residues 23 129, designated L1), and the 33 -kDa protein consisted of the heavy chain (residues 130 38 8) and a light chain designated ... Spermosin type (33 kDa) may start from Ser 23 (see Figs and 3) The active site residues in serine proteases, histidine, aspartic acid, and serine, were located at residues 178, 230 , and 32 4, respectively,...
- 7
- 493
- 0
Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx
Ngày tải lên :
07/08/2014, 18:21
... 91 .3 90.5 92.1 21 21 21 25 26 20 13 14 15 27 27 28 24 28 24 27 90.4 91.6 91.4 30 30 30 27 27 27 33 32 33 31 31 35 34 31 34 34 38 99.7 91.5 31 31 31 27 27 26 34 33 32 32 32 34 34 32 34 34 38 91.8 ... 38 99.7 91.5 31 31 31 27 27 26 34 33 32 32 32 34 34 32 34 34 38 91.8 34 34 34 29 28 28 30 32 31 33 33 30 31 35 35 30 31 31 30 Percent identities between sequences of Ehrlichia chaffeensis 16S ... Ehrlichia chaffeensis 16S rRNA gene fragment (39 6 bp) sequences No 1 10 11 12 13 14 15 16 17 18 19 20 21 0 10 11 12 13 13 13 15 15 15 17 21 30 31 34 10 11 12 13 14 15 16 17 18 19 20 21 100 100 100 98.5...
- 5
- 353
- 0
Báo cáo y học: " Comparative evaluation of INNO-LiPA HBV assay, direct DNA sequencing and subtractive PCR-RFLP for genotyping of clinical HBV isolates" pot
Ngày tải lên :
12/08/2014, 04:20
... pGEM-T Easy plasmid as KWT1 KWT2 KWT3 KWT4 KWT5 KWT6 KWT7 KWT8 KWT9 KWT10 KWT11 KWT12 KWT 13 X59795 KWT14 AJ34 4116 AY1 6115 7 KWT15 AB 033 559 KWT16 AB078 032 AY0904 53 AY741796 AB126581 AB104712 AY721605 ... (X59795-ITALY, AJ34 4116 -FRANCE, AY1 6115 7-INDIA, AB 033 559-PAPUA, AB078 032 -JAPAN, AY0904 53- SWEDEN, AY741796-IRAN, AB126581-RUSSIA, AB104712-EGYPT and AY721605-TURKEY) Ali et al Virology Journal 2010, 7 :111 ... http://www.virologyj.com/content/7/1 /111 strains isolated in Italy, France, Russian Federation, Sweden, India, Japan and Papua New Guinea [GenBank: X59795, AJ34 4116 , AB126581, AY0904 53, AY1 6115 7, AB078 032 and AB 033 559; respectively]...
- 5
- 370
- 0
Analysis, sequencing and in vitro expression of PCR products
Ngày tải lên :
25/10/2013, 22:20
... 32 0 33 0 TGGTCTTCTTGGCATCGTTGCCACCTGTTGACTACGATCTGACCGTTACCATCCATGGAGATACCAGGCCAGAACATA 34 0 33 0 36 0 37 0 38 0 39 0 400 410 Figure 5.6 Direct sequencing of PCR products by cycle sequencing The process ... TGGGCTATAGACTTCGCCATTCTTCTCAAATACGCCACCGCTCCAGGAGCCTCCAATGGTAAAAACACGACCGTCTGACATGC 180 190 200 210 220 230 240 250 (C) GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT 260 270 280 290 30 0 31 0 32 0 33 0 TGGTCTTCTTGGCATCGTTGCCACCTGTTGACTACGATCTGACCGTTACCATCCATGGAGATACCAGGCCAGAACATA ... primer 5′-CGTTGTAAAACGACGGCCAGT -3 ; ● M 13/ pUC –48 reverse sequencing primer 5′-AGCGGATAACAATTTCACACAGGA -3 ;] ● M 13/ pUC –24 reverse sequencing primer 5′-AACAGCTATGACCATG -3 ; ● T7 promoter/universal...
- 24
- 494
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
Ngày tải lên :
20/02/2014, 02:21
... CAD62446 CAD677 73 NP_0005 63 AAC64705 CAA 430 90 A348 53 43. 2 37 .6 28.0 28.5 25.2 25.2 45.7 39 .3 26.6 26.6 25.1 25.1 CAA248 63 27.4 AAB26148 28.0 CAA248 63 27.0 26.9 26.6 25.7 AAG16755 NP_0 6119 4 AAK62468 ... IL-10 sequences used in the alignment are as follows: human, NP_0005 63; cat, AAC64708; rat, CAA 430 90; mouse, A348 53 Ó FEBS 20 03 4650 R Savan et al (Eur J Biochem 270) Table Identities of cellular, ... Res 22, 4 13 419 10 Savan, R., Kono, T., Aman, A & Sakai, M (20 03) Isolation and characterization of a novel CXC chemokine in common carp (Cyprinus carpio L.) Mol Immunol 39 , 829– 834 11 Fujiki,...
- 8
- 584
- 0
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx
Ngày tải lên :
07/03/2014, 21:20
... sequence 10 11 12 13 Neutral Neutral Other Basic QH Basic QH Basic Y Basic Y Basic Y Basic Y Basic QH Basic QH Other Basic G 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 P1 ... melanogaster homolog A gambiae homolog GC2555, GC 132 7, GC 234 2 GC1919, GC 132 7 AACO5656-5668 GC 234 1, GC1252, GC 236 0 GC32 036 , GC14959 GC14959, GC1 430 1 GC169 63 FEBS Journal 272 (2005) 4774–4786 ª 2005 FEBS ... basic G13A (accession number AB201771), basic G13B (AB201772) and basic G13C (AB2017 73) , were identified Gly8 in G13A was replaced by Glu in G3B, and Leu7 in G13A was replaced by Val in G13C The...
- 13
- 582
- 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
Ngày tải lên :
08/03/2014, 08:20
... Enzymol 264, 139 –148 25 Walberg, M.W & Clayton, D.A (19 83) In vitro transcription of human mitochondrial DNA Identification of specific light strand 26 27 28 29 30 31 32 33 34 35 36 37 38 39 transcripts ... band interacting with the DNA 1 13 8 V Camasamudram et al (Eur J Biochem 270) Ó FEBS 20 03 Ó FEBS 20 03 Mitochondrial transcription termination (Eur J Biochem 270) 1 13 9 Fig Factor-dependent termination ... EDTA, 5% glycerol, 100 ng Ó FEBS 20 03 1 13 0 V Camasamudram et al (Eur J Biochem 270) dI:dC, 0.1–0.2 ng 32 P-labelled gel purified double-stranded DNA probe (30 000 c.p.m.) and 2–5 lg mt protein...
- 13
- 415
- 0
DNA Sequencing – Methods and Applications Edited by Anjana Munshi pptx
Ngày tải lên :
08/03/2014, 19:20
... 69.7 (3. 5) 73. 5 (7.6) 67.7 (10.0) 72.7 (5.1) 72 .3 (6 .3) 78 .3 (2.5) 67.9 (7.9) 73. 6 (2.1) 68.9 (11. 5) 97.2 (2.6) 98.2 (1.5) 99.2 (0.8) 98 .3 (0.6) 98.8 (1 .3) 99.4 (0.7) 99.4 (0.7) 99.8 (0 .3) 99 .3 (0.7) ... Nucleic Acids Res 13 (7): 239 9–412 doi:10.10 93/ nar/ 13. 7. 239 9 PMC 3 4116 3 PMID 4000959 [ 13] Base-calling for next-generation sequencing platforms — Brief Bioinform" Retrieved 2 011- 02-24 [14] Murphy, ... 77 .3 (4.7) 80.4 (2.0) 99 .3 (0.6) 99.5 (0.2) 600.4 (1.1) 601.0 (0.7) 70 75 80 90 100 13. 0 (19.5) 63. 9 (35 .8) 51.6 (29.0) 50.7 (31 .2) 70.7 (5.6) 69.6 (27.1) 52.9 (33 .2) 49.9 (37 .8) 61.9 (8.9) 79.3...
- 184
- 928
- 0
Báo cáo khoa học: Site-directed mutagenesis and footprinting analysis of the interaction of the sunflower KNOX protein HAKN1 with DNA ppt
Ngày tải lên :
23/03/2014, 13:20
... (5¢-CAACTGGTTCAAAAACCAAAGGAA -3 ), (5¢-TTCCTTTGGTTTTTGAACCAGTTG -3 ), K54VF (5¢TAAACCARAGGGTGCGGCAYTGGA -3 ), K54VR (5¢TCCARTGCCGCACCCTYTGGTTTA -3 ), R55AF (5¢-CA AAGGAAGGCGCACTGGAA -3 ), R55AR (5¢-TTCCAG TGCGCCTTCCTTTG -3 ), ... Laughon A (1991) DNA binding specificity of homeodomains Biochemistry 30 , 1 13 57 1 13 67 28 Tioni MF, Gonzalez DH & Chan RL (20 03) Knotted1like genes are strongly expressed in differentiated cell ... 1047–1054 41 Schwede T, Kopp J, Guex N & Peitsch MC (20 03) SWISS-MODEL: an automated protein homology-modeling server Nucleic Acids Res 31 , 33 81 33 85 42 Bertolino E, Reimund B, Wildt-Perinic D & Clerc...
- 13
- 558
- 0
Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx
Ngày tải lên :
30/03/2014, 04:20
... the F- 233 construct (MF- 233 ) and transfected MF- 233 and F- 233 into A549 and DU145 cells, respectively Luciferase assays showed that MF- 233 displayed lower luciferase activity than F- 233 (Fig ... )36 2 ) 233 ⁄ )214 )1 13 ⁄ )94 )97 ⁄ )78 ) 83 ⁄ )64 )71 ⁄ )52 )126 ⁄ )107 )146 ⁄ )127 )175 ⁄ )156 )229 ⁄ )210 )35 0 ⁄ )33 1 )39 6 ⁄ )37 7 )492 ⁄ )4 73 a In relation to the translation start site at ) 2116 , ... )36 ⁄ )17 ) 2116 ⁄ )2097 )1712 ⁄ )16 93 ) 837 ⁄ )818 )685 ⁄ )666 ) 637 ⁄ )618 )619 ⁄ )600 )599 ⁄ )580 )580 ⁄ )561 )560 ⁄ )541 )542 ⁄ )5 23 )5 23 ⁄ )504 )5 03 ⁄ )484 )466 ⁄ )147 )418 ⁄ )39 9 )38 1 ⁄ )36 2...
- 14
- 340
- 0
Báo cáo khoa học: Tracking interactions that stabilize the dimer structure of starch phosphorylase from Corynebacterium callunae Roles of Arg234 and Arg242 revealed by sequence analysis and site-directed mutagenesis doc
Ngày tải lên :
31/03/2014, 01:20
... ± 1.17 ± 0. 03/ 3.2 ± 0.1 2.95 ± 0.10/stableb R 234 A R242A ± 3/ n.a 3. 8 ± 0.4/n.a 2.60 ± 0.06/20 ± 2.00 ± 0.02/12 ± 0.5 4.45 ± 0.05/stableb 2. 93 ± 0.02/stableb + phosphatea 5.2 (3. 45 3. 55 2.27 ± ... 5¢-ATCGAAGCC GAGCGCGTTTCC -3 (R 234 A); 5¢-GAACGCGAGGCC GTTTCC -3 (R 236 A); and 5¢-GATATCTGCGCCGT GCTC -3 (R242A) A 1400-bp fragment of the StP gene, obtained by digestion of pQE 30 -StP with SphI and ... in the GenBank database, two well-conserved peptides, GNGGLGRL (residues 131 – 138 in rmGP) and TNHTLMPEAL (residues 37 4 38 3 in rmGP), were chosen and reverse translated into a pair of degenerated...
- 11
- 444
- 0
bioinformatics sequence and genome analysis - david w. mount
Ngày tải lên :
08/04/2014, 12:44
... letters A, B, F Thus, hexadecimal 0F corresponds to binary 0000 111 1 and decimal 15, and FF corresponds to binary 111 1 111 1 and decimal 255 A DNA sequence is usually stored and read in the ... CompCheck: 6 430 GapWeight: 12 GapLengthWeight: list4.msf Name: Name: Name: Name: MSF: 8 83 haywire xpb-human rad25 xpb-ara Type: P Len: Len: Len: Len: February 28, 1997 16:42 8 83 8 83 8 83 8 83 Check: ... current sequence position at the end of each row Page 1.1 15 16 30 31 45 gi| 730 305| MATHHTLWMGLALLG VLGDLQAAPEAQVSV QPNFQQDKFLGRWFS 23 gi|40 439 0| - -APEAQVSV QPNFQPDKFLGRWFS 45 gi|895868 MAALRMLWMGLVLLG...
- 565
- 510
- 0
Báo cáo hóa học: " Research Article Binocular Image Sequence Analysis: Integration of Stereo Disparity and Optic Flow for Improved Obstacle Detection and Tracking" pptx
Ngày tải lên :
21/06/2014, 22:20
... 150 3 −5 200 −1 150 3 −5 200 −7 50 100 150 200 250 30 0 (c) Vertical motion displacement of right images −7 50 100 150 200 250 30 0 (d) Vertical motion displacement of right images Figure 3: Optic ... horizontal coordinate x (pixel) (a) The longitudinal distance 30 15.5 15 14.5 3. 5 2.5 1.5 14 13. 5 10 20 30 40 50 60 70 80 0.5 90 100 10 20 30 40 50 60 70 80 90 100 Frames Frames (c) Measured horizontal ... 63, no 3, pp 430 –446, 1996 [12] Y Zhang and C Kambhamettu, “On 3- D scene flow and structure recovery from multiview image sequences,” IEEE Transactions on Systems, Man, and Cybernetics B, vol 33 ,...
- 10
- 363
- 0
Báo cáo hóa học: " Autoregressive Modeling and Feature Analysis of DNA Sequences" pot
Ngày tải lên :
23/06/2014, 01:20
... [19] [20] [21] [22] [ 23] [24] [25] [26] [27] [28] [29] [30 ] [31 ] [32 ] [33 ] [34 ] [35 ] [36 ] [37 ] DNA: a signature of the nucleosomal structure,” Phys Rev Lett., vol 86, no 11, pp 2471–2474, 2001 ... features DNA segment 210–217 (template) 5174–5181 12572–12579 19278–19285 29624–29 631 36 387 36 394 55805–55812 631 06–6 31 13 CTCACATT CTCACATT CTCACATT AATGTGAG CTCACATT AATGTGAG AATGTGAG CTCACATT Table ... sequences [18, 39 , 40, 41] 3. 3 Numerical mapping of nucleotides Numerical mapping can be broadly classified into two types, namely, fixed mapping as in [1, 2, 4, 5, 6, 7, 8, 13, 16, 17, 24, 33 ] and a...
- 16
- 331
- 0
Báo cáo khoa học: " Sequence Analysis of Canine LINE-1 Elements and p53 Gene in Canine Transmissible Venereal Tumor" doc
Ngày tải lên :
07/08/2014, 15:20
... * * ** * * * * ** * * * * *A * * * * 954 30 40 981 31 20 1008 32 00 1 034 32 80 1061 33 60 1088 34 40 111 4 35 20 114 1 36 00 116 8 36 80 119 4 37 60 1221 38 40 1248 39 20 1274 4000 1275 4080 G A CT G C T A AC ... | | | | | | | | | | | | | | | GGAGCCAGGGGGAAGCAGG 39 0 450 510 570 430 690 750 810 870 930 659 990 1050 738 1069 Fig Sequence comparison of p 53 DNA binding region from TVT cell and normal cell ... , B a n d R u tte m a n , G R P 53 mutations in mammary tumor cell lines and corresponding tumor tissues in the dog Anticancer Res., 1996, 16, 37 37 -37 44 23 Veldhoen, N., Stew art, J , Brow...
- 8
- 263
- 0
Minireview Maize DNA-sequencing strategies and genome organization Ron J Okagaki and Ronald L ppt
Ngày tải lên :
09/08/2014, 20:20
... genome Genome Biology 2004, 5:2 23 http://genomebiology.com/2004/5/5/2 23 Genome Biology 2004, Volume 5, Issue 5, Article 2 23 Okagaki and Phillips 2 23. 3 References 10 13 14 16 17 19 20 interactions ... 2 23. 2 Genome Biology 2004, Volume 5, Issue 5, Article 2 23 Okagaki and Phillips repetitive In contrast, 35 % of the 95, 233 methylation-filtered and 21% of 100,000 ... Martienssen RA, McCombie WR: Maize genome sequencing by methylation filtration Science 20 03, 30 2: 2115 - 2117 Whitelaw CA, Barbazuk WB, Pertea G, Chan AP, Cheung F, Lee Y, Zheng L, van Heeringen...
- 3
- 249
- 0
Signal sequence analysis of expressed sequence tags from the nematode Nippostrongylus brasiliensis and the evolution of secreted proteins in parasites potx
Ngày tải lên :
09/08/2014, 20:20
... vector Volume 5, Issue 6, Article R39 R39.14 Genome Biology 2004, 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Volume 5, Issue 6, Article R39 Harcus et al protective immunity ... YYYYS 0.754 19 0.9 93 Y Y Unknown NBC00 633 1 53 4e -38 CE 036 39 YYYYS 0.450 17 1.000 Y Y Transthyretin-like family NBC00641 145 1e 35 CE 332 89 YYYYS 0.219 19 0. 930 Y Y Unknown NBC006 43 102 2e-22 CE27850 ... Transport-secretion protein NBC00197 1 43 8e -35 CE00 431 YYYYS 0.557 16 1.000 Y N Globin NBC00272 144 2e -35 CE32475 YYNYS 0.262 22 0.5 13 Y N Unknown NBC0 032 8 147 4e -36 CE00 431 YYYYS 0.5 23 17 0.999 Y N Globin NBC00581...
- 15
- 416
- 0